LOC567442

Ensembl ID:
ENSDARG00000061990
Human Orthologue:
KCNH4
Human Description:
potassium voltage-gated channel, subfamily H (eag-related), member 4 [Source:HGNC Symbol;Acc:6253]
Mouse Orthologue:
Kcnh4
Mouse Description:
potassium voltage-gated channel, subfamily H (eag-related), member 4 Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22053 Essential Splice Site Mutation detected in F1 DNA During 2016
sa9678 Nonsense Available for shipment Available now
sa10935 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22053
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089042 Essential Splice Site 271 1193 6 17
Genomic Location (Zv9):
Chromosome 12 (position 14539888)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13395541
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTTTGAGCAGACTTGTGCAGCAAAGTCATTATCCTACCTTTTACTTTC[A/T]GACATCATTCTTAACTTTCGCACCACCTATGTGAGTCAATCAGGACAAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089042 Nonsense 482 1193 9 17
Genomic Location (Zv9):
Chromosome 12 (position 14545543)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13401196
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAATGTAACAGCTATTATCCAGCGCATGTACTCACGTCGCTCACTATA[T/A]CATACACGCATGAAAGATCTAAAGGACTTCATTCGRGTTCACCGGCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10935
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089042 Nonsense 748 1193 12 17
Genomic Location (Zv9):
Chromosome 12 (position 14567551)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 13423204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATCATTAGGGAACCTTTTAGGAGAGGAGTTAATGCAATTCAATGCCCTA[C/T]GACATTGTCGCTCACCCGTCAGGGGCTGGAGTCCAAATCCCKCTCCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link