si:ch211-241e15.2

Ensembl ID:
ENSDARG00000061985
ZFIN ID:
ZDB-GENE-030131-9612
Description:
RNA-binding protein 47 [Source:RefSeq peptide;Acc:NP_001108158]
Human Orthologue:
RBM47
Human Description:
RNA binding motif protein 47 [Source:HGNC Symbol;Acc:30358]
Mouse Orthologue:
Rbm47
Mouse Description:
RNA binding motif protein 47 Gene [Source:MGI Symbol;Acc:MGI:2384294]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa13150 Essential Splice Site Available for shipment Available now
sa38255 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa13150
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089070 Essential Splice Site 387 601 2 5
ENSDART00000135552 Essential Splice Site 387 600 4 7

The following transcripts of ENSDARG00000061985 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18107914)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18673082
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATCCATACAACACACTCATCGGACCCAACCGAGACTACTTCATTAAAG[G/A]TTGGAGAACTCATTATCTCTCTTTAATATATCAGATTGAACAAATGTGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38255
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089070 Nonsense 418 601 3 5
ENSDART00000135552 Nonsense 417 600 5 7

The following transcripts of ENSDARG00000061985 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 18105887)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 18671055
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGGGGCCCAGGGCCCCGCGGCTCATACCTTGGTGGCTATTCAGCTGGC[C/T]GAGGCATTTACAGCCGCTACCATGAAGGAAAGACCAAATTGCCGGACAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link