
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
lap3
- Ensembl ID:
- ENSDARG00000061981
- ZFIN ID:
- ZDB-GENE-060719-1
- Description:
- cytosol aminopeptidase [Source:RefSeq peptide;Acc:NP_001108319]
- Human Orthologue:
- LAP3
- Human Description:
- leucine aminopeptidase 3 [Source:HGNC Symbol;Acc:18449]
- Mouse Orthologue:
- Lap3
- Mouse Description:
- leucine aminopeptidase 3 Gene [Source:MGI Symbol;Acc:MGI:1914238]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31202 | Essential Splice Site | Available for shipment | Available now |
sa19470 | Essential Splice Site | Available for shipment | Available now |
sa24839 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa12960 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31202
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089025 | Essential Splice Site | 178 | 517 | 5 | 13 |
- Genomic Location (Zv9):
- Chromosome 1 (position 18168319)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 18733487 GRCz11 1 19426424 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGCTCAAGACCAAAAAGAAGGTCCATGTCAAGACCCGACCACATGGGAG[G/A]TACAGTTACACACAAATCTTCCCTAACACACCATAAAAATGTGTCTCTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19470
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089025 | Essential Splice Site | 286 | 517 | 7 | 13 |
- Genomic Location (Zv9):
- Chromosome 1 (position 18167011)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 18732179 GRCz11 1 19425116 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CGGCACAGCCTCCTCTTGTGCTGGTGGGCAAAGGAATCACCTTTGACAGG[T/G]AACTATACCTGAGCAGAATTTAAACACATCTGTAGTTGTTAAATACAGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa24839
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089025 | Essential Splice Site | 357 | 517 | 9 | 13 |
- Genomic Location (Zv9):
- Chromosome 1 (position 18166626)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 18731794 GRCz11 1 19424731 - KASP Assay ID:
- 554-7604.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAACAAGCCGGGTGATGTTGTTCGCGCCAAAAATGGCAAAACCATTCAGG[T/C]ATTTAGTAACACTTCACTTGACTGTCATAACATCTTTCTAATCATGACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12960
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000089025 | Essential Splice Site | 418 | 517 | 11 | 13 |
- Genomic Location (Zv9):
- Chromosome 1 (position 18164680)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 18729848 GRCz11 1 19422785 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCACTGGAGTGTTCACTAAYTCTGATTGGCTGTGGGAGCGGCTRCATAAG[G/T]TAATAATAYGTGATGTGRCTGTCATGTGATTGTCAGAATGACGATTGTCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: