lap3

Ensembl ID:
ENSDARG00000061981
ZFIN ID:
ZDB-GENE-060719-1
Description:
cytosol aminopeptidase [Source:RefSeq peptide;Acc:NP_001108319]
Human Orthologue:
LAP3
Human Description:
leucine aminopeptidase 3 [Source:HGNC Symbol;Acc:18449]
Mouse Orthologue:
Lap3
Mouse Description:
leucine aminopeptidase 3 Gene [Source:MGI Symbol;Acc:MGI:1914238]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19470 Essential Splice Site Mutation detected in F1 DNA During 2014
sa24839 Essential Splice Site Mutation detected in F1 DNA During 2014
sa12960 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa19470
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089025 Essential Splice Site 286 517 7 13
Genomic Location:
Chromosome 1 (position 18167011)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGCACAGCCTCCTCTTGTGCTGGTGGGCAAAGGAATCACCTTTGACAGG[T/G]AACTATACCTGAGCAGAATTTAAACACATCTGTAGTTGTTAAATACAGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24839
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089025 Essential Splice Site 357 517 9 13
Genomic Location:
Chromosome 1 (position 18166626)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAAGCCGGGTGATGTTGTTCGCGCCAAAAATGGCAAAACCATTCAGG[T/C]ATTTAGTAACACTTCACTTGACTGTCATAACATCTTTCTAATCATGACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12960
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089025 Essential Splice Site 418 517 11 13
Genomic Location:
Chromosome 1 (position 18164680)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCACTGGAGTGTTCACTAAYTCTGATTGGCTGTGGGAGCGGCTRCATAAG[G/T]TAATAATAYGTGATGTGRCTGTCATGTGATTGTCAGAATGACGATTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/06mxtksg