ppfibp2a

Ensembl ID:
ENSDARG00000061977
ZFIN ID:
ZDB-GENE-070705-277
Description:
Novel protein similar to H.sapien PPFIBP2, PTPRF interacting protein, binding protein 2 (Liprin beta
Human Orthologue:
PPFIBP2
Human Description:
PTPRF interacting protein, binding protein 2 (liprin beta 2) [Source:HGNC Symbol;Acc:9250]
Mouse Orthologue:
Ppfibp2
Mouse Description:
PTPRF interacting protein, binding protein 2 (liprin beta 2) Gene [Source:MGI Symbol;Acc:MGI:894649]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36672 Nonsense Mutation detected in F1 DNA During 2017
sa16101 Essential Splice Site Available for shipment Available now
sa43125 Essential Splice Site Mutation detected in F1 DNA During 2017
sa36673 Nonsense Mutation detected in F1 DNA During 2017
sa43126 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11866 Essential Splice Site Available for shipment Available now
sa9503 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa36672
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089031 Nonsense 70 826 3 23
ENSDART00000135633   None 441 None 10
ENSDART00000143617   None 209 None 7
Genomic Location (Zv9):
Chromosome 18 (position 29100931)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 29173493
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGGCTCAGGGAGCGAAGATAAGAGACCTGGAGAATTCTCTTGGGGAATA[T/A]CAGCACAAGCTGAACTCCACTGAGGAGATGCTTCAACAGGTATTGGTAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16101
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089031 Essential Splice Site 179 826 None 23
ENSDART00000135633   None 441 None 10
ENSDART00000143617 Essential Splice Site 81 209 None 7

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 18 (position 29112526)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 29184783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTATGGCAGTGAGCCAGCACAAGCTTCTCAGACWGAACCAAAGCCGACGG[T/C]RAGTCTGAGATCTGGACATTTAGACAAATGTAAACAKTCTGGAACTGTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43125
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089031 Essential Splice Site 416 826 15 23
ENSDART00000135633 Essential Splice Site 31 441 2 10
ENSDART00000143617   None 209 None 7
Genomic Location (Zv9):
Chromosome 18 (position 29136313)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 29208570
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAATTTGTTGTTTTGTCATGCTTATTGATTCACTCTCATTTTTGCTTTAC[A/T]GAAACAATGAAGGACACAACCAATTCTGATCTTTCTTCAGTATCGTCTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36673
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089031 Nonsense 534 826 17 23
ENSDART00000135633 Nonsense 149 441 4 10
ENSDART00000143617   None 209 None 7
Genomic Location (Zv9):
Chromosome 18 (position 29136875)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 29209132
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGGTTTGGGTCAGTATGTCAGTTTGGCCCGCCAGTGGGTGGATAGTGGA[C/T]AAACCCTCCTCTCTGCAACTCCACAGGAACTTGAGAAGGTTTGTTTTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43126
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089031 Essential Splice Site 583 826 18 23
ENSDART00000135633 Essential Splice Site 198 441 5 10
ENSDART00000143617   None 209 None 7
Genomic Location (Zv9):
Chromosome 18 (position 29138526)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 29210783
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAACAAGACAATGGAGAAATCTTCCGAACTGGATCATATCTGGGTTACAC[G/A]TATGTAATAATCTTAATATTTTAAACTTAATGAAGCTGAACTGTTGCCCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11866
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089031 Essential Splice Site 584 826 18 23
ENSDART00000135633 Essential Splice Site 199 441 5 10
ENSDART00000143617   None 209 None 7
Genomic Location (Zv9):
Chromosome 18 (position 29138527)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 29210784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ARCAAGACAATGGAGAAATCTTCYGAACTGGATCATATCTGGRTTACACG[T/A]ATGTAATAATCTTWATATTTTAAACYTAATGAAGCTGAACTGTTGCCCTM
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089031 Essential Splice Site 696 826 21 23
ENSDART00000135633 Essential Splice Site 311 441 8 10
ENSDART00000143617   None 209 None 7
Genomic Location (Zv9):
Chromosome 18 (position 29140296)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 29212553
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGAATATGCTCCAAACYTGAGAGGCAGTGGTGTTCATGGAGGCCTAATT[G/A]TGAGTCCCAGGGGCTACATACATATGAGGGGGYACCACACAAACTACTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link