si:ch211-87a2.1

Ensembl ID:
ENSDARG00000061976
ZFIN ID:
ZDB-GENE-081105-129
Description:
Novel protein similar to H.sapiens SEMA6B, sema domain, transmembrane domain (TM), and cytoplasmic d
Human Orthologue:
SEMA6B
Human Description:
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B [Source:HGNC Symbol;
Mouse Orthologue:
Sema6b
Mouse Description:
sema domain, transmembrane domain (TM), and cytoplasmic domain, (semaphorin) 6B Gene [Source:MGI Sym

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9705 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9705
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013640 Nonsense 608 874 16 16
ENSDART00000089024 Nonsense 608 639 16 16
Genomic Location (Zv9):
Chromosome 8 (position 19461642)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 18906280
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTTTCCGCRTTTGCCACTGGGGCGGCGCTGTCGGGTCTTATGGTGTGTTG[G/A]ATAATGAGCCTCAAACACCGCCAGCGTTCCARAGCCAATGGATCTGGCTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link