grhl2b

Ensembl ID:
ENSDARG00000061974
ZFIN ID:
ZDB-GENE-060503-719
Description:
grainyhead-like protein 2 homolog [Source:RefSeq peptide;Acc:NP_001076541]
Human Orthologue:
GRHL2
Human Description:
grainyhead-like 2 (Drosophila) [Source:HGNC Symbol;Acc:2799]
Mouse Orthologue:
Grhl2
Mouse Description:
grainyhead-like 2 (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:2182543]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36799 Essential Splice Site Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36799
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088994 Essential Splice Site 183 554 5 15
Genomic Location (Zv9):
Chromosome 19 (position 12864438)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 12322784
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATTTATCTCTCACACACCTAAAAAAAACATGCTCTAATGTTGTTCAAC[A/T]GAGACACATTTCAATACACACTAGAGGCCAGCAAGTCATTGCGGCAAAAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link