si:dkey-172o19.1

Ensembl ID:
ENSDARG00000061970
ZFIN ID:
ZDB-GENE-060503-54
Description:
leucine rich repeat and Ig domain containing 3 [Source:RefSeq peptide;Acc:NP_001076323]
Human Orthologue:
LINGO3
Human Description:
leucine rich repeat and Ig domain containing 3 [Source:HGNC Symbol;Acc:21206]
Mouse Orthologue:
Lingo3
Mouse Description:
leucine rich repeat and Ig domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:3609246]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa24158 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa24158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089033 Nonsense 139 605 1 1
Genomic Location (Zv9):
Chromosome 22 (position 20895611)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20550287
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGCCTTTTCACGTCTCACCAACCTCACAACTCTGGACCTAAGTGGGAAT[A/T]AACTAGTAATCCTGTTAGACTTCACCTTTCAGGACTTGAGGAACCTCCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link