myo1ha

Ensembl ID:
ENSDARG00000061968
ZFIN ID:
ZDB-GENE-060531-78
Description:
Novel myosin head motor domain containing protein [Source:UniProtKB/TrEMBL;Acc:A2BGM6]
Mouse Orthologue:
Myo1h
Mouse Description:
myosin 1H Gene [Source:MGI Symbol;Acc:MGI:1914674]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31422 Nonsense Available for shipment Available now
sa40386 Essential Splice Site Mutation detected in F1 DNA During 2016
sa40387 Nonsense Mutation detected in F1 DNA During 2016
sa990 Essential Splice Site Available for shipment Available now
sa40388 Nonsense Mutation detected in F1 DNA During 2016
sa33563 Nonsense Mutation detected in F1 DNA During 2016
sa20375 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31422
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089014 Nonsense 192 1036 5 31
ENSDART00000146215 Nonsense 185 1027 5 30
Genomic Location (Zv9):
Chromosome 5 (position 21198126)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18910998
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTGATTCTAATACACAGGGAGATGCTGTCGGTGGCCACATACTCAGTTA[C/A]CTGCTGGAAAAGTCGAGAGTGGTTCACCAAAACCATGGTGAGAGAAACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40386
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089014 Essential Splice Site 313 1036 8 31
ENSDART00000146215 Essential Splice Site 306 1027 8 30
Genomic Location (Zv9):
Chromosome 5 (position 21199969)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18912841
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACTTATTTTTAAATATCCGTGTAACATTCCTGTTTAATGTTGATGCTC[A/C]GCTGTTAGGTGTCCATGTTCAAGTCCTTCATGGAGCTCTTACATTTAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40387
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089014 Nonsense 389 1036 10 31
ENSDART00000146215 Nonsense 378 1027 10 30
Genomic Location (Zv9):
Chromosome 5 (position 21200514)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18913386
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTCACCACTTTTTTTGTGTTTAGGATTCTGAAAGGAAGACTGTCATT[G/T]GATTGCTTGACATCTATGGATTTGAGGTATTCACTGCTAACAGGTATGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089014 Essential Splice Site 438 1036 11 31
ENSDART00000146215 Essential Splice Site 427 1027 11 30
Genomic Location (Zv9):
Chromosome 5 (position 21202685)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18915557
KASP Assay ID:
554-0894.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTGACGCTGAAGGCTGAACAGGAGGAGTATGAAGCAGAAGGAATCGGG[G/T]TGAGTTTATCAGTCATTCAGTAATCACGTATGCAATGAYATTCAAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40388
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089014 Nonsense 635 1036 18 31
ENSDART00000146215 Nonsense 624 1027 18 30
Genomic Location (Zv9):
Chromosome 5 (position 21208820)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18921692
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCTAGGGTTGATGGAGCACCTGAGGGTCAGGCGAGCTGGATTTGCATA[T/A]CGCCGTAAATATGAGGTCTTTCTAAAGAGGTAAACTTAAATTAATAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33563
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089014   None 1036 None 31
ENSDART00000146215 Nonsense 1020 1027 30 30
Genomic Location (Zv9):
Chromosome 5 (position 21217752)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18930624
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCCATGATTTATAAAGGCCCAAATGGACACCTGATGGTGGTGAGTGATT[T/A]AGTTTTGTATTTGTACTTGATTTAATATTATCGTTCCTATTCTTACACTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20375
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089014 Nonsense 1036 1036 31 31
ENSDART00000146215   None 1027 None 30
Genomic Location (Zv9):
Chromosome 5 (position 21217838)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 18930710
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTATTCTTACACTATTTCATTATCAAAGGTGGCTCCACGGATCAAGTCA[C/T]GATGATCTGAAGGAGGTCAGCAAGTCTGTGTATATTTCATGAGGGAAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link