myo1ha

Ensembl ID:
ENSDARG00000061968
ZFIN ID:
ZDB-GENE-060531-78
Description:
Novel myosin head motor domain containing protein [Source:UniProtKB/TrEMBL;Acc:A2BGM6]
Mouse Orthologue:
Myo1h
Mouse Description:
myosin 1H Gene [Source:MGI Symbol;Acc:MGI:1914674]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa990 Essential Splice Site Available for shipment Available now
sa20375 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa990
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089014 Essential Splice Site 438 1036 11 31
ENSDART00000146215 Essential Splice Site 427 1027 11 30
Genomic Location:
Chromosome 5 (position 21202685)
KASP Assay ID:
554-0894.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTTGACGCTGAAGGCTGAACAGGAGGAGTATGAAGCAGAAGGAATCGGG[G/T]TGAGTTTATCAGTCATTCAGTAATCACGTATGCAATGAYATTCAAAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089014 Nonsense 1036 1036 31 31
ENSDART00000146215 None None 1027 None 30
Genomic Location:
Chromosome 5 (position 21217838)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTATTCTTACACTATTTCATTATCAAAGGTGGCTCCACGGATCAAGTCA[C/T]GATGATCTGAAGGAGGTCAGCAAGTCTGTGTATATTTCATGAGGGAAACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/0ibc38e0