LOC563188

Ensembl ID:
ENSDARG00000061956
Human Orthologue:
SYTL2
Human Description:
synaptotagmin-like 2 [Source:HGNC Symbol;Acc:15585]
Mouse Orthologue:
Sytl2
Mouse Description:
synaptotagmin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1933366]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa27625 Essential Splice Site Mutation detected in F1 DNA During 2016
sa13534 Essential Splice Site Available for shipment Available now
sa8436 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa27625
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088973 Essential Splice Site 370 909 11 27
Genomic Location (Zv9):
Chromosome 10 (position 29995631)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29368075
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGAGAACAAACCAGACAAACTCTGTGAAGAACCTTCTCAACAAGAAAG[G/A]TTTGACCAAGATGAAGTATCAACGGGAAGACTGGTCAACCTGAAGTCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13534
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088973 Essential Splice Site 380 909 12 27
Genomic Location (Zv9):
Chromosome 10 (position 29995991)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29368435
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAGAACCTTTTATTTTGGACAACCATAAGGCCTCKGAAARCTCAAGCAG[T/A]RAGCTACATACTCTTGTTGAGTATAATGCGCTAGACAGTGATCAACAAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8436
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088973 Nonsense 810 909 26 27
Genomic Location (Zv9):
Chromosome 10 (position 30004578)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 29377022
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
YGCAATCCTCCCAGAGAACAACAGGAAAAGCCGTCAGAAGACCAGAGTGT[T/A]GAAGAGGGCTCCAAACCCAGTGTTTAACCACACCATGGTTTATGATGGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link