golgb1

Ensembl ID:
ENSDARG00000061951
ZFIN ID:
ZDB-GENE-030429-9
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BH11]
Human Orthologue:
GOLGB1
Human Description:
golgin B1 [Source:HGNC Symbol;Acc:4429]
Mouse Orthologue:
Golgb1
Mouse Description:
golgi autoantigen, golgin subfamily b, macrogolgin 1 Gene [Source:MGI Symbol;Acc:MGI:1099447]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa20273 Nonsense Available for shipment Available now
sa5263 Nonsense F2 line generated During 2014
sa9148 Nonsense Mutation detected in F1 DNA During 2014
sa11389 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20273
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088963 Nonsense 444 3355 7 19
ENSDART00000131402 None None 619 None 9
ENSDART00000133810 None None 328 None 8
ENSDART00000140424 None None 242 None 4
Genomic Location:
Chromosome 4 (position 21264558)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGAAAGCATCTCTAGAAGCTAGATTAGAAACGGAAAGTGAAAATAAA[C/T]AGACTATCGGTGAATTAAGAGTTGAATTACAAACAAAAATGGCAGAGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5263
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088963 Nonsense 541 3355 7 19
ENSDART00000131402 None None 619 None 9
ENSDART00000133810 None None 328 None 8
ENSDART00000140424 None None 242 None 4
Genomic Location:
Chromosome 4 (position 21264267)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGATCACAGAACTGGATGAAATGAGAGCAAAGCTTAAATTTGAAGAATGT[G/T]AAAAGCAAACAAAAGCAGTCGAGTTGGATGAAATGAGAGAAAAACTTGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9148
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088963 Nonsense 2375 3355 10 19
ENSDART00000131402 None None 619 None 9
ENSDART00000133810 None None 328 None 8
ENSDART00000140424 None None 242 None 4
Genomic Location:
Chromosome 4 (position 21254389)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAAAGAGCAGAGGCTGAGGCTGAGACAGGCAAACAGAGGGAGCTGGAA[C/T]AGAAATTGAAATCAGCACAGAGGTTTAAAGAAGGTAGTCAAAACAGAACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11389
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088963 Nonsense 2948 3355 13 19
ENSDART00000131402 Nonsense 212 619 3 9
ENSDART00000133810 None None 328 None 8
ENSDART00000140424 None None 242 None 4
Genomic Location:
Chromosome 4 (position 21252344)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGGGAAGATCTTGTGAACCACATTCAAGCTTTCGAAAAAGACATTGCA[C/T]AAGGCAGGGCACCAYTGTTGGAGCAGGAAWACTTRAGYCAGGCTAGYGAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/svqk61po