cngb3

Ensembl ID:
ENSDARG00000061945
ZFIN ID:
ZDB-GENE-090611-1
Human Orthologue:
CNGB3
Human Description:
cyclic nucleotide gated channel beta 3 [Source:HGNC Symbol;Acc:2153]
Mouse Orthologue:
Cngb3
Mouse Description:
cyclic nucleotide gated channel beta 3 Gene [Source:MGI Symbol;Acc:MGI:1353562]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
hu2483 Nonsense Available for shipment Available now
sa25215 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
hu2483
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083904 Nonsense 297 585 10 16
ENSDART00000088953 Nonsense 360 645 10 17
ENSDART00000113731 Nonsense 290 572 10 16
ENSDART00000135928 None None 238 None 5
ENSDART00000145337 Nonsense 195 490 6 13
Genomic Location:
Chromosome 24 (position 31133729)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAGATATCTGCGCTGTTATTACTTCGCCACTCGTACCCTGATCACTATC[G/T]GAGGTCTGCCGGAGCCCCATACGCTCTTCGAGATCGTCTTCCAGCTCGTC
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa25215
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000083904 Nonsense 353 585 11 16
ENSDART00000088953 Nonsense 416 645 11 17
ENSDART00000113731 Nonsense 346 572 11 16
ENSDART00000135928 None None 238 None 5
ENSDART00000145337 Nonsense 251 490 7 13
Genomic Location:
Chromosome 24 (position 31133974)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGGCAGGTCAAACGTACTTCAGAGCATCTATGGATTCTTGCGTGGCGTA[T/A]ATGAACACCTACACCATTCCCAAACTGGTCCAGAGCAGAGTTCGCACCTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/b6q4s6hs