trpv4

Ensembl ID:
ENSDARG00000061941
ZFIN ID:
ZDB-GENE-030912-7
Description:
transient receptor potential cation channel subfamily V member 4 [Source:RefSeq peptide;Acc:NP_0010
Human Orthologue:
TRPV4
Human Description:
transient receptor potential cation channel, subfamily V, member 4 [Source:HGNC Symbol;Acc:18083]
Mouse Orthologue:
Trpv4
Mouse Description:
transient receptor potential cation channel, subfamily V, member 4 Gene [Source:MGI Symbol;Acc:MGI:1

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa2266 Nonsense Mutation detected in F1 DNA During 2014
sa8180 Nonsense Mutation detected in F1 DNA During 2014
sa5288 Nonsense Mutation detected in F1 DNA During 2014
sa1671 Nonsense Available for shipment Available now
sa15329 Nonsense Available for shipment Available now
sa2270 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa2266
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088937 Nonsense 48 841 1 15
ENSDART00000138186 Nonsense 63 856 1 15
Genomic Location:
Chromosome 5 (position 21616452)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCAATGGCAGCGCTACTGGAAAATGATGATGTATCACAGCCAACTCAT[G/T]AATTGCCTCGACCAGGACAACAGAACGACCAGAAGCAGAACATGCGGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8180
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088937 Nonsense 345 841 5 15
ENSDART00000138186 Nonsense 360 856 5 15
Genomic Location:
Chromosome 5 (position 21592500)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACAACACACGTTTTGTCACTAAGATGTTTGACTTGCTGCTCATTAAATG[T/A]GCCAAACTCTACYCRGATTGCAACCTGGAGAATATACTCAACAACGACGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5288
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088937 Nonsense 620 841 11 15
ENSDART00000138186 Nonsense 635 856 11 15
Genomic Location:
Chromosome 5 (position 21584057)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAGATTTGTTCCGGTTCCTGCTGKTCTACGTGCTCTTCATGATTGGTTA[T/A]GCTTCAGGTATTCCAATAAGAATCATCACTCTTGTTTAATATCTTCTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1671
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088937 Nonsense 641 841 12 15
ENSDART00000138186 Nonsense 656 856 12 15
Genomic Location:
Chromosome 5 (position 21583903)
KASP Assay ID:
554-1617.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTCGCTGTTGACCATCTGCCCTGATAAGGACACGTGTAAGGAAAACTG[T/A]CCTACATATCCCGAATGTCGAGACACAAACACCTTCAGTGAATTCTTGCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15329
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088937 Nonsense 764 841 13 15
ENSDART00000138186 Nonsense 779 856 13 15
Genomic Location:
Chromosome 5 (position 21581754)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGATGGTYACTGTGGGCAAGGGTTTGGATGGAAAGCCAGAYAAAYGCT[G/A]GTGCTTCAGRTACAGCAACAAAATATCTGCTACATTTATGTTTATTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2270
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088937 Nonsense 803 841 14 15
ENSDART00000138186 Nonsense 818 856 14 15
Genomic Location:
Chromosome 5 (position 21581515)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCAGGCCAGAAAGACCTTTCTGAACACACACAGGGTGGACGGGGCCTT[C/T]GAAGAGGTWAGTTAAKGGGCAAATTATTTAAAAAAAACTATATTTTTGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/enkfofqk