HTR4

Ensembl ID:
ENSDARG00000061940
Description:
5-hydroxytryptamine (serotonin) receptor 4 [Source:HGNC Symbol;Acc:5299]
Human Orthologue:
HTR4
Human Description:
5-hydroxytryptamine (serotonin) receptor 4 [Source:HGNC Symbol;Acc:5299]
Mouse Orthologue:
Htr4
Mouse Description:
5 hydroxytryptamine (serotonin) receptor 4 Gene [Source:MGI Symbol;Acc:MGI:109246]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa6344 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa6344
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088940 Nonsense 126 243 2 3
Genomic Location (Zv9):
Chromosome 14 (position 26278030)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 24902729
KASP Assay ID:
554-4406.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCGCAACCACCGGATGCGCACCGAGACCAAGGCAGCCAAGACTCTGTG[C/A]ATCATCATGGGCTGCTTCTGCCTATGCTGGGCCCCGTTCTTCATCACAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link