myo7aa

Ensembl ID:
ENSDARG00000061937
ZFIN ID:
ZDB-GENE-020709-1
Description:
myosin-VIIa [Source:RefSeq peptide;Acc:NP_694515]
Human Orthologue:
MYO7A
Human Description:
myosin VIIA [Source:HGNC Symbol;Acc:7606]
Mouse Orthologue:
Myo7a
Mouse Description:
myosin VIIA Gene [Source:MGI Symbol;Acc:MGI:104510]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11378 Nonsense Available for shipment Available now
sa23224 Essential Splice Site Mutation detected in F1 DNA During 2014
sa16521 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088945 Nonsense 1415 2179 30 47
Genomic Location:
Chromosome 18 (position 6483917)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGGCTCTGAGATCCTCGTTGAGAGACTGTTRAGTCTGATTCCCTCCYA[C/A]ATCCCGGACAGAGAGATCAGCTCGGCCAAGACTGTGGAGAGATGGGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23224
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088945 Essential Splice Site 1522 2179 32 47
Genomic Location:
Chromosome 18 (position 6481398)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTCTGGAGCTCTCCTTCCCAGAGATCACAGCCGTGTCCAGCAGCAAG[T/C]ACGACTTTAATACTGTGATTTACCTGCAGGGATTATACAGCTGAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088945 Nonsense 1742 2179 37 47
Genomic Location:
Chromosome 18 (position 6472160)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGTGTWTGATYCTCCTTGACCGTKTKTCCTGCACCAGTAATGAAGTA[T/A]ATGGGTGATTATCCGTCTAAACGCACACGCTCAGTGAACGARCTCACGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bnkvtiyl