myo7aa

Ensembl ID:
ENSDARG00000061937
ZFIN ID:
ZDB-GENE-020709-1
Description:
myosin-VIIa [Source:RefSeq peptide;Acc:NP_694515]
Human Orthologue:
MYO7A
Human Description:
myosin VIIA [Source:HGNC Symbol;Acc:7606]
Mouse Orthologue:
Myo7a
Mouse Description:
myosin VIIA Gene [Source:MGI Symbol;Acc:MGI:104510]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36566 Nonsense Available for shipment Available now
sa28974 Nonsense Mutation detected in F1 DNA During 2016
sa11378 Nonsense Available for shipment Available now
sa28973 Essential Splice Site Mutation detected in F1 DNA During 2016
sa23224 Essential Splice Site Available for shipment Available now
sa16521 Nonsense Available for shipment Available now
sa36565 Essential Splice Site Mutation detected in F1 DNA During 2016
sa39188 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa36566
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088945 Nonsense 1066 2179 23 47
Genomic Location (Zv9):
Chromosome 18 (position 6493270)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3146890
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGGTGACCTTCCCGAACCCAAATACCACACGGCCATCAGCGACGGCAGC[G/T]AGAAGATCCCTGTCATGACCAAAATCTACGAGACACTCGGAAAGAAAACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28974
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088945 Nonsense 1396 2179 30 47
Genomic Location (Zv9):
Chromosome 18 (position 6483974)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3156186
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTTCCGGGTGAAGGAGGATCTGGCGGAGCTGGCGTCGCAGCAGTATTA[T/A]GTAGATTACGGCTCTGAGATCCTCGTTGAGAGACTGTTGAGTCTGATTCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11378
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088945 Nonsense 1415 2179 30 47
Genomic Location (Zv9):
Chromosome 18 (position 6483917)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3156243
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGGCTCTGAGATCCTCGTTGAGAGACTGTTRAGTCTGATTCCCTCCYA[C/A]ATCCCGGACAGAGAGATCAGCTCGGCCAAGACTGTGGAGAGATGGGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa28973
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088945 Essential Splice Site 1480 2179 31 47
Genomic Location (Zv9):
Chromosome 18 (position 6482227)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3157933
KASP Assay ID:
2261-1802.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGTGGCCTTTATTATTCTCCAGATTCTACGAGGCCTTCAAGTTTTCAGG[T/A]ATTTATTTTTTCGTTATGTCAGATTAATGTGAGAAACTGCAGGCAAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23224
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088945 Essential Splice Site 1522 2179 32 47
Genomic Location (Zv9):
Chromosome 18 (position 6481398)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3158762
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTCTGGAGCTCTCCTTCCCAGAGATCACAGCCGTGTCCAGCAGCAAG[T/C]ACGACTTTAATACTGTGATTTACCTGCAGGGATTATACAGCTGAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088945 Nonsense 1742 2179 37 47
Genomic Location (Zv9):
Chromosome 18 (position 6472160)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3168000
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTGTGTGTWTGATYCTCCTTGACCGTKTKTCCTGCACCAGTAATGAAGTA[T/A]ATGGGTGATTATCCGTCTAAACGCACACGCTCAGTGAACGARCTCACGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36565
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088945 Essential Splice Site 1789 2179 37 47
Genomic Location (Zv9):
Chromosome 18 (position 6472019)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3168141
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGAGATTTACTGTCAGATCCTTAAACAGCTGACAGAAAACCACATCAA[G/T]TACGTCATTTATAAACACTCTATAGTGGTCAAAAGCTTACACTAAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088945 Nonsense 1817 2179 38 47
Genomic Location (Zv9):
Chromosome 18 (position 6471196)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 3168964
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGCTGTGTGTTGGTCTCTTTCCTCCCAGTAATGTCCTCTTACCACACGTC[C/T]AGCGCTTTCTACAGTCCAAGAAACATCATCCTCTGGCTCTGGACTGCATG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link