amotl2a
- Ensembl ID:
- ENSDARG00000061923
- ZFIN ID:
- ZDB-GENE-030131-9770
- Description:
- angiomotin-like protein 2 [Source:RefSeq peptide;Acc:NP_001073646]
- Human Orthologue:
- AMOTL2
- Human Description:
- angiomotin like 2 [Source:HGNC Symbol;Acc:17812]
- Mouse Orthologue:
- Amotl2
- Mouse Description:
- angiomotin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1929286]
Alleles
There are 8 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa44636 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa18416 |
Essential Splice Site |
Available for shipment |
Available now |
sa20712 |
Essential Splice Site |
Available for shipment |
Available now |
sa20713 |
Nonsense |
Available for shipment |
Available now |
sa40700 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa18236 |
Nonsense |
Available for shipment |
Available now |
sa16774 |
Splice Site, Nonsense |
Available for shipment |
Available now |
sa33875 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa44636
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 6 (position 27700287)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
28001498 |
GRCz11 |
6 |
27992059 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCTGGAGAAGCTCTCCAGGCGCGCACGCACGAACATACGCATGGAAATG[T/G]AAGTCGTACTCAACATATTTCCAGAAGGATTATATCTTTAAACATAGAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18416
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 6 (position 27702120)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
28003331 |
GRCz11 |
6 |
27993892 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TGAAAAGAGAAGTGGACAGCTACAGTGAGAAGGCGGCAAGGTTACAGAAG[G/A]TAACAGGATTCTTTGTGTGATTGCAASTTCSTTGCAACCTTCTAGAACTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20712
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 6 (position 27702121)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
28003332 |
GRCz11 |
6 |
27993893 |
- KASP Assay ID:
- 2259-7601.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAAAAGAGAAGTGGACAGCTACAGTGAGAAGGCGGCAAGGTTACAGAAGG[T/C]AACAGGATTCTTTGTGTGATTGCAACTTCCTTGCAACCTTCTAGAACTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20713
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 27703854)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
28005065 |
GRCz11 |
6 |
27995626 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGAAGCCCTTGAGAAAACCATGAGGAACAAGCTAGAGAGTGAGATCAAG[C/T]GACTTCATGACTTTAACAGAGATCTCAGGGGTAAGATGGTTCGCATAGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40700
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 27705625)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
28006836 |
GRCz11 |
6 |
27997397 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGAAGAGGCGTCGTGAAGCCTTGGAGCAAGCACTTATCACAGCTCAGACA[C/T]GAAATAGGCAGCTGGAAGAAGAGTTACGTAGGAAGAGAGCTTATGTGGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa18236
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 27705710)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
28006921 |
GRCz11 |
6 |
27997482 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GAGAGCTTATGTGGAGAAGGTGGAAAGGATGCAGAGTGCATTGGCRCAAT[T/A]GCAGGCAGCATGTGAGAAGAGGGAAGCWCTGGAGTTACGACTTAGRACCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16774
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Splice Site, Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 27705796)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
28007007 |
GRCz11 |
6 |
27997568 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TACGACTTAGRACCAGACTGGAGCAGGAGCTGAAGAGTTTGAGAGCACAG[C/T]AGGTAAAAGAAAAAACAGACAACYTCTGTTCAATAAGAATCAACAATTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33875
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 27707053)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
28008264 |
GRCz11 |
6 |
27998825 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCAATTTCAGGGAAGAGCCTATCAGATGACCAGACAGCAGTCGCATCTT[T/A]GCCCCCATTGCCCCATCTGCTTGCCAAAATCCAGTGTCGAGACAGCAGCA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: