amotl2a

Ensembl ID:
ENSDARG00000061923
ZFIN ID:
ZDB-GENE-030131-9770
Description:
angiomotin-like protein 2 [Source:RefSeq peptide;Acc:NP_001073646]
Human Orthologue:
AMOTL2
Human Description:
angiomotin like 2 [Source:HGNC Symbol;Acc:17812]
Mouse Orthologue:
Amotl2
Mouse Description:
angiomotin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1929286]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18416 Essential Splice Site Available for shipment Available now
sa20712 Essential Splice Site Available for shipment Available now
sa20713 Nonsense Available for shipment Available now
sa18236 Nonsense Available for shipment Available now
sa16774 Splice Site, Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18416
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088914 Essential Splice Site 306 721 3 11
ENSDART00000139367 None None 41 None 2
ENSDART00000141354 None None 185 None 2
ENSDART00000143974 None None 131 None 2
Genomic Location:
Chromosome 6 (position 27702120)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAAAAGAGAAGTGGACAGCTACAGTGAGAAGGCGGCAAGGTTACAGAAG[G/A]TAACAGGATTCTTTGTGTGATTGCAASTTCSTTGCAACCTTCTAGAACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20712
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088914 Essential Splice Site 306 721 3 11
ENSDART00000139367 None None 41 None 2
ENSDART00000141354 None None 185 None 2
ENSDART00000143974 None None 131 None 2
Genomic Location:
Chromosome 6 (position 27702121)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAAGAGAAGTGGACAGCTACAGTGAGAAGGCGGCAAGGTTACAGAAGG[T/C]AACAGGATTCTTTGTGTGATTGCAACTTCCTTGCAACCTTCTAGAACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20713
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088914 Nonsense 345 721 4 11
ENSDART00000139367 None None 41 None 2
ENSDART00000141354 None None 185 None 2
ENSDART00000143974 None None 131 None 2
Genomic Location:
Chromosome 6 (position 27703854)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAAGCCCTTGAGAAAACCATGAGGAACAAGCTAGAGAGTGAGATCAAG[C/T]GACTTCATGACTTTAACAGAGATCTCAGGGGTAAGATGGTTCGCATAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18236
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088914 Nonsense 453 721 6 11
ENSDART00000139367 None None 41 None 2
ENSDART00000141354 None None 185 None 2
ENSDART00000143974 None None 131 None 2
Genomic Location:
Chromosome 6 (position 27705710)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGCTTATGTGGAGAAGGTGGAAAGGATGCAGAGTGCATTGGCRCAAT[T/A]GCAGGCAGCATGTGAGAAGAGGGAAGCWCTGGAGTTACGACTTAGRACCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16774
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088914 Splice Site, Nonsense 482 721 6 11
ENSDART00000139367 None None 41 None 2
ENSDART00000141354 None None 185 None 2
ENSDART00000143974 None None 131 None 2
Genomic Location:
Chromosome 6 (position 27705796)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACGACTTAGRACCAGACTGGAGCAGGAGCTGAAGAGTTTGAGAGCACAG[C/T]AGGTAAAAGAAAAAACAGACAACYTCTGTTCAATAAGAATCAACAATTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/28msw34r