LOC100000112

Ensembl ID:
ENSDARG00000061909

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa42329 Nonsense Mutation detected in F1 DNA During 2016
sa42330 Nonsense Mutation detected in F1 DNA During 2016
sa31969 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa42329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088833 Nonsense 56 1015 1 4
Genomic Location (Zv9):
Chromosome 14 (position 2317122)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2481458
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGTTGGAGCACGGGGCTTTCGTGGGGAATATTGCTGAGGACTTGGGCT[T/A]GGACGTGGCTAAACTGTCTTCACGGAGATTCCGGATTGTGTCCGGAGCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088833 Nonsense 99 1015 1 4
Genomic Location (Zv9):
Chromosome 14 (position 2317250)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2481330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAACGGGATTTTGTTTGTGAATGAGAAGATTGACCGTGAGGAGCTCTGT[G/T]AACAAAGTCCCGTTTGTTTCCTGCACTTGCAGGTGGTCATTGAGAACCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31969
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088833 Nonsense 590 1015 1 4
Genomic Location (Zv9):
Chromosome 14 (position 2318725)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 2479855
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACGGCTCCGTGGCTACCGAGATGGTGCCCAGATCTGTGGACTCTGGGTA[T/A]CTTGTTGCTAAAATCACGGCTCTAGATGCAGACGCGGGACAAAACTCTCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link