si:dkey-218h11.4

Ensembl ID:
ENSDARG00000061908
ZFIN ID:
ZDB-GENE-030131-4642
Description:
hypothetical protein LOC561964 [Source:RefSeq peptide;Acc:NP_001038437]
Human Orthologue:
C19orf28
Human Description:
chromosome 19 open reading frame 28 [Source:HGNC Symbol;Acc:28299]
Mouse Orthologue:
F630110N24Rik
Mouse Description:
RIKEN cDNA F630110N24 gene Gene [Source:MGI Symbol;Acc:MGI:3604804]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19739 Nonsense Available for shipment Available now
sa25108 Essential Splice Site Mutation detected in F1 DNA During 2017
sa11445 Nonsense Available for shipment Available now
sa8957 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa19739
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088867 Nonsense 276 489 5 10
ENSDART00000099702 Nonsense 276 506 5 11
Genomic Location (Zv9):
Chromosome 2 (position 22546523)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23433228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTCAAATCTTCTCTAAACTCTGCTTTTTTATTCAGGTTGCACTGCTTTA[T/A]ATGTCCACCAGACTGATAGTAAACCTGTCACAAACATACATCTCCATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25108
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088867 Essential Splice Site 390 489 7 10
ENSDART00000099702 Essential Splice Site 390 506 7 11
Genomic Location (Zv9):
Chromosome 2 (position 22548631)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23435336
KASP Assay ID:
554-7415.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTGGTCATGTCTCTTGCCATGACGGCTGAACTCATAGGAGACCAGACA[G/A]TAAGTATTGATCAAGCACATGCTATCAAACAAATGTTTTTCTGTGTGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11445
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088867   None 489 None 10
ENSDART00000099702 Nonsense 469 506 10 11
ENSDART00000088867   None 489 None 10
ENSDART00000099702 Nonsense 469 506 10 11
Genomic Location (Zv9):
Chromosome 2 (position 22552714)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23439419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGATTCTCCTCATGGCTGACGTGTTGTTTTGTATTTCAGTATCTAAG[C/T]GAGGTCATATGAACGGTTCAATAAACGGCAATGGCTCAAAGGGTGAGGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8957
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088867   None 489 None 10
ENSDART00000099702 Nonsense 469 506 10 11
ENSDART00000088867   None 489 None 10
ENSDART00000099702 Nonsense 469 506 10 11
Genomic Location (Zv9):
Chromosome 2 (position 22552714)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 23439419
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACTGATTCTCCTCATGGCTGACGTGTTGTTTTGTATTTCAGTATCTAAG[C/T]GAGGTCATATGAACGGTTCAATAAACGGCAATGGCTCAAAGGGTGAGGGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link