si:ch211-209d1.1

Ensembl ID:
ENSDARG00000061904
ZFIN IDs:
ZDB-GENE-041114-132, ZDB-GENE-041114-132, ZDB-GENE-081028-61
Description:
Zgc:103746 [Source:UniProtKB/TrEMBL;Acc:Q5U3C6]
Human Orthologue:
FHOD3
Human Description:
formin homology 2 domain containing 3 [Source:HGNC Symbol;Acc:26178]
Mouse Orthologue:
Fhod3
Mouse Description:
formin homology 2 domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:1925847]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12499 Nonsense Available for shipment Available now
sa12518 Nonsense Available for shipment Available now
sa36094 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa12499
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088818 Nonsense 194 1549 6 27
ENSDART00000131438   None 847 None 11
ENSDART00000143185 Nonsense 194 320 6 9
ENSDART00000088818 Nonsense 194 1549 6 27
ENSDART00000131438   None 847 None 11
ENSDART00000143185 Nonsense 194 320 6 9

The following transcripts of ENSDARG00000061904 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 20659800)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18896555
KASP Assay ID:
2260-9512.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATGTAGAWGGAATGAATGGGCTTATCGGACACAATGAAACYGTACAGT[G/A]GCTGTACACACTGGTTGGAWCAAAGGTAAAGGACATTCSACGTCTAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12518
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088818 Nonsense 194 1549 6 27
ENSDART00000131438   None 847 None 11
ENSDART00000143185 Nonsense 194 320 6 9
ENSDART00000088818 Nonsense 194 1549 6 27
ENSDART00000131438   None 847 None 11
ENSDART00000143185 Nonsense 194 320 6 9

The following transcripts of ENSDARG00000061904 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 20659800)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18896555
KASP Assay ID:
2260-9512.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTATGTAGAWGGAATGAATGGGCTTATCGGACACAATGAAACYGTACAGT[G/A]GCTGTACACACTGGTTGGAWCAAAGGTAAAGGACATTCSACGTCTAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088818 Nonsense 1514 1549 26 27
ENSDART00000131438 Nonsense 812 847 10 11
ENSDART00000143185   None 320 None 9

The following transcripts of ENSDARG00000061904 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 20567520)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 18804275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGAAATCAGCCACTCAGGGCCCCAGTCAGAGAACACAGCCTCGTGAGAGG[A/T]GACGTTCCAGAGCAAACCGCAAATCCTGTGAGTCTCAAACACTAATTAAT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link