LOC100334576

Ensembl ID:
ENSDARG00000061899
Human Orthologue:
IQUB
Human Description:
IQ motif and ubiquitin domain containing [Source:HGNC Symbol;Acc:21995]
Mouse Orthologue:
Iqub
Mouse Description:
IQ motif and ubiquitin domain containing Gene [Source:MGI Symbol;Acc:MGI:3041159]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa38094 Essential Splice Site Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088817 Essential Splice Site 93 749 1 12
Genomic Location (Zv9):
Chromosome 25 (position 28740818)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 27430912
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAATAAGATCATTTCTTCCAATGATGTTGGAAACTCAACAGCAACGGG[T/G]AAATACTAGAATCCATAGTATTGGTATCTAGGTATGACAGTTTTGTAATA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link