LOC100334576

Ensembl ID:
ENSDARG00000061899
Human Orthologue:
IQUB
Human Description:
IQ motif and ubiquitin domain containing [Source:HGNC Symbol;Acc:21995]
Mouse Orthologue:
Iqub
Mouse Description:
IQ motif and ubiquitin domain containing Gene [Source:MGI Symbol;Acc:MGI:3041159]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38094 Essential Splice Site Mutation detected in F1 DNA During 2016
sa8063 Nonsense Mutation detected in F1 DNA During 2016
sa8064 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa38094
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088817 Essential Splice Site 93 749 1 12
Genomic Location:
Chromosome 25 (position 28740818)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAATAAGATCATTTCTTCCAATGATGTTGGAAACTCAACAGCAACGGG[T/G]AAATACTAGAATCCATAGTATTGGTATCTAGGTATGACAGTTTTGTAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8063
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088817 Nonsense 591 749 10 12
Genomic Location:
Chromosome 25 (position 28770864)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTTTTCTCTAAAGACTAATGAATCGGCMGTCGGCATCTGTCGYCGMTG[T/A]ATGGAMTTAGACAATGAAGCCCGTCGAAGAGAAGACTTCTCTCTTTAKAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8064
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088817 Nonsense 607 749 10 12
Genomic Location:
Chromosome 25 (position 28770912)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGWATGGAMTTAGACAATGAAGCCCGTCGAAGAGAAGACTTCTCTCTTTA[T/G]AAGAACATYCTGAGGTGCCTGCGTGACACTGAAGCCGAGAGCAGCCCWGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link