LOC557981

Ensembl ID:
ENSDARG00000061895
Human Orthologues:
AC053481.2, USP32
Human Description:
ubiquitin specific peptidase 32 [Source:HGNC Symbol;Acc:19143]
Mouse Orthologue:
Usp32
Mouse Description:
ubiquitin specific peptidase 32 Gene [Source:MGI Symbol;Acc:MGI:2144475]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3943 Nonsense Mutation detected in F1 DNA During 2014
sa1084 Essential Splice Site F2 line generated During 2014
sa2801 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3943
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088808 Nonsense 404 1585 12 34
Genomic Location:
Chromosome 15 (position 23196798)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCACGGTTTACAGCCCAGTCAAAACTGGTTCCTGATCTCCATGCAGTGGT[G/A]GCAGCAATGGAAAGACTATGTCAGATATGTGAGTATTCTTTATATARCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1084
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088808 Essential Splice Site 1140 1585 27 34
Genomic Location:
Chromosome 15 (position 23183907)
KASP Assay ID:
554-0986.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGCAAGTCCACTGCCGCCGCAGGAAGCCAGYAACCATGCTCAAGACTG[G/A]TCAGTGGCRTCATGTTTGTTTGTTTGTTTGTTTTTTATTTTGTTGTTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2801
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088808 Nonsense 1287 1585 31 34
Genomic Location:
Chromosome 15 (position 23180305)
KASP Assay ID:
554-2881.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCATTTCAGATYGTTCATTTGAAACGCTTCCAATTTGTAAATGGTCGATG[G/A]ATCAAGTCTCAGAAGATTGTGAAGTTTCCACGCGAGAGCTTCGACCCCAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/6q6h8v0n