atp13a2

Ensembl ID:
ENSDARG00000061890
ZFIN ID:
ZDB-GENE-061215-126
Description:
probable cation-transporting ATPase 13A2 [Source:RefSeq peptide;Acc:NP_001073506]
Human Orthologue:
ATP13A2
Human Description:
ATPase type 13A2 [Source:HGNC Symbol;Acc:30213]
Mouse Orthologue:
Atp13a2
Mouse Description:
ATPase type 13A2 Gene [Source:MGI Symbol;Acc:MGI:1922022]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1158 Essential Splice Site Available for shipment Available now
sa14250 Nonsense Available for shipment Available now
sa18624 Nonsense Available for shipment Available now
sa3236 Essential Splice Site F2 line generated During 2014
sa6735 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa1158
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088777 Essential Splice Site 493 1170 15 29
ENSDART00000132265 None None 75 None 4
Genomic Location:
Chromosome 23 (position 24820924)
KASP Assay ID:
554-1069.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGCCTCGCATTAACATCTGTGGCAAGAWATCACTTTTCTGCTTTGATAAG[G/A]TGAGACAATGCGATTTGYKAAGATGATCTATATCACTTCATTWGAAATGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14250
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088777 Nonsense 718 1170 20 29
ENSDART00000132265 None None 75 None 4
Genomic Location:
Chromosome 23 (position 24809841)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTGATGAAGAACCAAGTGAAGCCAGAAAGTGCTGAAGTCATTCAAACTT[T/A]AACTCTGGCACAGTTACGGCCTGTGATGGTTACAGGTACGTACAAAAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18624
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088777 Nonsense 819 1170 22 29
ENSDART00000132265 None None 75 None 4
Genomic Location:
Chromosome 23 (position 24807205)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTATAAATGGGATGTCCTTTGCAGCACTTTGTGATCATTTCCCTGAATA[T/G]CTACCCAAGGTGACTTGGATTGAGTTTTACAAATATTGATTCATTCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa3236
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088777 Essential Splice Site 900 1170 24 29
ENSDART00000132265 None None 75 None 4
Genomic Location:
Chromosome 23 (position 24803833)
KASP Assay ID:
554-3217.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCCTTCACATCCAAATCTGACAACATCAGCTGCGTGCCTTTACTCATCAA[G/T]TAAATGACACGTTGTTATGTTGTTATCTATTCGATAAAGTGTRTTGTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6735
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088777 Essential Splice Site 1116 1170 29 29
ENSDART00000132265 None None 75 None 4
Genomic Location:
Chromosome 23 (position 24800253)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TMYGAAACACACTCTTAGTAACTCATCTTTTATTCTTTTTTATATCCACA[G/A]TTTTTCATTGACCAAGGTGCCCTGAACTGCCTTCGAAACCTCAGAGGAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: A genome-wide association study in 19 633 Japanese subjects identified LHX3-QSOX2 and IGF1 as adult height loci. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/s97xgaij