si:dkey-149i17.9

Ensembl ID:
ENSDARG00000061887
ZFIN ID:
ZDB-GENE-070912-376

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30819 Essential Splice Site Mutation detected in F1 DNA During 2017
sa39832 Essential Splice Site Mutation detected in F1 DNA During 2017
sa16089 Nonsense Available for shipment Available now
sa18395 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa30819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088795 Essential Splice Site 44 258 2 5
ENSDART00000134936   None 212 None 3
ENSDART00000088795 Essential Splice Site 44 258 2 5
ENSDART00000134936   None 212 None 3
Genomic Location (Zv9):
Chromosome 2 (position 24667949)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25242726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGCAATTAAGTTTGCCAACACCAAGAACGTCAAGTTCATCGACATT[G/A]TAAGTATGCTGTGCTCTTCTACTCTCATTCACTGTTTCATTTCACCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39832
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088795 Essential Splice Site 44 258 2 5
ENSDART00000134936   None 212 None 3
ENSDART00000088795 Essential Splice Site 44 258 2 5
ENSDART00000134936   None 212 None 3
Genomic Location (Zv9):
Chromosome 2 (position 24667949)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25242726
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGGTGGCAATTAAGTTTGCCAACACCAAGAACGTCAAGTTCATCGACATT[G/A]TAAGTATGCTGTGCTCTTCTACTCTCATTCACTGTTTCATTTCACCTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16089
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088795 Nonsense 157 258 3 5
ENSDART00000134936 Nonsense 113 212 1 3
Genomic Location (Zv9):
Chromosome 2 (position 24667477)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25242254
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTCCTGATCAAYCCAGACACCCTYGAAGTCAAATTGATCGACTTTGGATG[C/A]GGGGAAATCCTCACCGATGCTCCTTACAGAGRTTTTGCTGGTATGTATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18395
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088795 Nonsense 211 258 4 5
ENSDART00000134936 Nonsense 167 212 2 3

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 24666816)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 25241593
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTCTCTCGGAGTACTCCTTTATGCGATGATGTGTGGGGAGTTTCCAAAT[C/T]GACACGACCTGCAAATGATCAGATATAACATCTGGACCAAAGATCACTTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link