satb2

Ensembl ID:
ENSDARG00000061885
ZFIN ID:
ZDB-GENE-070912-212
Description:
DNA-binding protein SATB2 [Source:RefSeq peptide;Acc:NP_001122004]
Human Orthologue:
SATB2
Human Description:
SATB homeobox 2 [Source:HGNC Symbol;Acc:21637]
Mouse Orthologue:
Satb2
Mouse Description:
special AT-rich sequence binding protein 2 Gene [Source:MGI Symbol;Acc:MGI:2679336]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31727 Nonsense Available for shipment Available now
sa11148 Essential Splice Site Available for shipment Available now
sa7194 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa31727
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088791 Nonsense 69 737 2 10
ENSDART00000088876 Nonsense 69 834 2 11
Genomic Location (Zv9):
Chromosome 9 (position 33629003)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32784949
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCGTGCTCTCTTGCAGGTTTGATGATTCCTGTCTTCTGCGTGGTGGAG[C/T]AGATGGATGGAGGGATGATTTCCGATGGAGAGAGCCGAGAGGAACATGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11148
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088791   None 737 None 10
ENSDART00000088876 Essential Splice Site 250 834 6 11
Genomic Location (Zv9):
Chromosome 9 (position 33612703)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32768649
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTTAGGYGATTATTTGTGGCAAGGACGGGAGGGCTCAGAAATCAAGG[G/T]TAAGCTCTAAAGTATCTTTGGGTAAAGGACTGACTTTGATTTCTTAGCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7194
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088791 Nonsense 716 737 10 10
ENSDART00000088876 Nonsense 730 834 11 11
Genomic Location (Zv9):
Chromosome 9 (position 33594022)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 32749968
KASP Assay ID:
554-5043.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGATCTGCCCAAACATACCATTGTTAAGTTCTTTCAGAACCAACGTWA[T/A]CATGTGAAGCATCATGGACGACTGAAGGAGCTCGGATCGGAGGGCGGCGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link