apbb2

Ensembl ID:
ENSDARG00000061880
ZFIN ID:
ZDB-GENE-090313-73
Human Orthologue:
APBB2
Human Description:
amyloid beta (A4) precursor protein-binding, family B, member 2 [Source:HGNC Symbol;Acc:582]
Mouse Orthologue:
Apbb2
Mouse Description:
amyloid beta (A4) precursor protein-binding, family B, member 2 Gene [Source:MGI Symbol;Acc:MGI:1084

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16258 Nonsense Available for shipment Available now
sa611 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088750 Nonsense 589 890 8 15
ENSDART00000138796 Nonsense 564 863 10 17
ENSDART00000146232   None 138 None 3

The following transcripts of ENSDARG00000061880 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 18711676)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCTGTAAACAACTGCATYCGTCAACTGTCCTACTGCAAGAATGAYATA[C/T]GAGACACTGTGGGCATCTGGGGAGAGGTGAGCTACAGCTACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088750 Nonsense 837 890 15 15
ENSDART00000138796 Nonsense 810 863 17 17
ENSDART00000146232   None 138 None 3

The following transcripts of ENSDARG00000061880 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 18734009)
KASP Assay ID:
554-0521.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTCTCACTTTTTGACTCTTTTTCTCCTTTATGTCTGCAGTTGAGGTA[T/G]CAGAAGTGTCWGGTGGCGCGTCCTCCATCTCAGAAAGCCTGCTCACAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zbv9jfku