apbb2

Ensembl ID:
ENSDARG00000061880
ZFIN ID:
ZDB-GENE-090313-73
Human Orthologue:
APBB2
Human Description:
amyloid beta (A4) precursor protein-binding, family B, member 2 [Source:HGNC Symbol;Acc:582]
Mouse Orthologue:
Apbb2
Mouse Description:
amyloid beta (A4) precursor protein-binding, family B, member 2 Gene [Source:MGI Symbol;Acc:MGI:1084

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16258 Nonsense Available for shipment Available now
sa611 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16258
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088750 Nonsense 589 890 8 15
ENSDART00000138796 Nonsense 564 863 10 17
ENSDART00000146232 None None 138 None 3

The following transcripts of ENSDARG00000061880 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 18711676)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCGCTGTAAACAACTGCATYCGTCAACTGTCCTACTGCAAGAATGAYATA[C/T]GAGACACTGTGGGCATCTGGGGAGAGGTGAGCTACAGCTACACACACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa611
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088750 Nonsense 837 890 15 15
ENSDART00000138796 Nonsense 810 863 17 17
ENSDART00000146232 None None 138 None 3

The following transcripts of ENSDARG00000061880 do not overlap with this mutation:

Genomic Location:
Chromosome 1 (position 18734009)
KASP Assay ID:
554-0521.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCTCTCACTTTTTGACTCTTTTTCTCCTTTATGTCTGCAGTTGAGGTA[T/G]CAGAAGTGTCWGGTGGCGCGTCCTCCATCTCAGAAAGCCTGCTCACAGGC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/zbv9jfku