ddx10

Ensembl ID:
ENSDARG00000061865
ZFIN ID:
ZDB-GENE-071022-2
Description:
Ddx10 protein [Source:UniProtKB/TrEMBL;Acc:Q0P3W4]
Human Orthologue:
DDX10
Human Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 [Source:HGNC Symbol;Acc:2735]
Mouse Orthologue:
Ddx10
Mouse Description:
DEAD (Asp-Glu-Ala-Asp) box polypeptide 10 Gene [Source:MGI Symbol;Acc:MGI:1924841]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa12383 Nonsense Available for shipment Available now
sa13228 Nonsense Available for shipment Available now
sa23939 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125785 Nonsense 99 875 3 24
Genomic Location (Zv9):
Chromosome 21 (position 24399154)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25084828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGTAGGTCTTCTTGAAGCTCAGTACAGGCAGCCTACAGAGATTCAGAGA[C/T]AGACCATTGGCTTTGCTTTGCAAGGCAGAGATGTTCTTGGTGCTGCCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13228
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125785 Nonsense 296 875 7 24
Genomic Location (Zv9):
Chromosome 21 (position 24403099)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25088773
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTTTTCCACAGTACTCCAGCCACCCTCGAGCAGAACTACGTGGTCTG[T/A]GAGCTGCACCAGAAAGTCAACATGCTCTACTCATTTTTGAGGAGTCACCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23939
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125785 Nonsense 500 875 12 24
Genomic Location (Zv9):
Chromosome 21 (position 24411292)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25096966
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGAACAAAGATGTCTTTGATGTGTTACAGCTCAAACTCCCTGAATA[T/A]GCCATGTGAGTGGATGCTGCCCAGTGCCAGCAGTCTTCTGTGTCTTCTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link