myo18l1

Ensembl ID:
ENSDARG00000061862
ZFIN ID:
ZDB-GENE-080423-1
Human Orthologue:
MYO18A
Human Description:
myosin XVIIIA [Source:HGNC Symbol;Acc:31104]
Mouse Orthologue:
Myo18a
Mouse Description:
myosin XVIIIA Gene [Source:MGI Symbol;Acc:MGI:2667185]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa18136 Essential Splice Site Available for shipment Available now
sa42546 Essential Splice Site Mutation detected in F1 DNA During 2016
sa22645 Splice Site, Nonsense Available for shipment Available now
sa22646 Nonsense Available for shipment Available now
sa2798 Nonsense F2 line generated During 2016
sa42547 Nonsense Mutation detected in F1 DNA During 2016

Mutation Details

Allele Name:
sa18136
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Essential Splice Site 411 2057 3 41
Genomic Location (Zv9):
Chromosome 15 (position 23370851)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24082038
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGCACGATGGGACTGTACTGGATGTRGATGAGGATGAYGTAGAAAAGG[T/G]CAGTCTTGCGATGCTCATCACATTACTGGCATTTCAGTATGCACACATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42546
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Essential Splice Site 927 2057 15 41
Genomic Location (Zv9):
Chromosome 15 (position 23400799)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24111986
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGGAAAGACTCTTCAGTTATTACAGTCCTGCGGATGGAGAGAGCAAAGG[T/A]CAACACACATCCCACATGCTCACACACACACGTCATTGCATGTAGATGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22645
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Splice Site, Nonsense 1329 2057 24 41
Genomic Location (Zv9):
Chromosome 15 (position 23429467)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24140654
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTCCGAGACCTCGGAGAGACTGAGGCTGGAGAAAGACATGAAGGATCTA[C/T]AGGTACAACACACCCACACACTTCAGAACAGATTCAGAGTTTTGACTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22646
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Nonsense 1682 2057 32 41
Genomic Location (Zv9):
Chromosome 15 (position 23450041)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24161228
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGGCTGATGCTCAGATCATGCTGGATCACCTGAAGAACAATGCACCCAGC[A/T]AGAGAGAGATCGCCCAGCTCAAGAACCAGGTCTGTTGTTCATCTCCCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2798
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Nonsense 1770 2057 35 41
Genomic Location (Zv9):
Chromosome 15 (position 23456175)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24167362
KASP Assay ID:
554-2826.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGGAATTCAGAATGWTTGACCCCWGTCTGGTGCATTCTTTTGCAGTCCT[C/A]ACAGAACTTGGCCCAGATCAGTGACCTACAGGCCCAGCTGGAGGAGGCTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42547
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088648 Nonsense 1775 2057 35 41
Genomic Location (Zv9):
Chromosome 15 (position 23456189)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 24167376
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATTGACCCCTGTCTGGTGCATTCTTTTGCAGTCCTCACAGAACTTGGCC[C/T]AGATCAGTGACCTACAGGCCCAGCTGGAGGAGGCTATGAAGGAGAAACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link