lman2

Ensembl ID:
ENSDARG00000061854
ZFIN ID:
ZDB-GENE-070209-149
Description:
lectin, mannose-binding 2 [Source:RefSeq peptide;Acc:NP_001075216]
Human Orthologue:
LMAN2
Human Description:
lectin, mannose-binding 2 [Source:HGNC Symbol;Acc:16986]
Mouse Orthologue:
Lman2
Mouse Description:
lectin, mannose-binding 2 Gene [Source:MGI Symbol;Acc:MGI:1914140]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2740 Nonsense F2 line generated During 2014

Mutation Details

Allele Name:
sa2740
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088690 Nonsense 167 354 4 8
ENSDART00000088690 Nonsense 167 354 4 8
Genomic Location:
Chromosome 14 (position 27426192)
KASP Assay ID:
554-2630.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATTTTGTAGGCCTGGCTATTTTTGTGGATACCTTCCGTAATGATCTCCAA[G/T]GAATGGATGTAAGTGTGCCATACTCATGGGTCCTTCTTTCTCTACAGGCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Chronic kidney disease: New loci associated with kidney function and chronic kidney disease. (View Study)
  • Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/394hnxfo