olfml3a

Ensembl ID:
ENSDARG00000061852
ZFIN ID:
ZDB-GENE-060825-31
Description:
Olfactomedin-like protein 3B [Source:UniProtKB/Swiss-Prot;Acc:Q0P3W2]
Human Orthologue:
OLFML3
Human Description:
olfactomedin-like 3 [Source:HGNC Symbol;Acc:24956]
Mouse Orthologue:
Olfml3
Mouse Description:
olfactomedin-like 3 Gene [Source:MGI Symbol;Acc:MGI:1914877]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4217 Nonsense Mutation detected in F1 DNA During 2014
sa17438 Nonsense Available for shipment Available now
sa710 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa4217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088697 Nonsense 58 394 2 3
Genomic Location:
Chromosome 23 (position 25078938)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACTCTGGCATGAGCAGAACAACCGCTACAACTCTGACCTGAAGGAGTTC[A/T]GACAGCAGGCCGCAGATCTGTTGGAGAAACTTAGCAAAGACCACAGCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17438
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088697 Nonsense 220 394 3 3
Genomic Location:
Chromosome 23 (position 25084221)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAAYGGCACAGGTCATGCAGTCTACGATGGCTTCCTATATTAYATCART[G/T]AAAGCTCAGAGCTCCAAGTGGTTAAATATGACCTGAYGAACAGTTCGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa710
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088697 Nonsense 359 394 3 3
Genomic Location:
Chromosome 23 (position 25084640)
KASP Assay ID:
554-0618.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTCTGATTTATTTCCCCAGGCGTTAYGGGGCCCATTCCAGCCTCAAATA[C/A]AACCCTGAGGAACGTCAGCTCTACGCTTGGGATGATGGGTATCAGATTCT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/qxr75afb