ENSDARG00000061850

Ensembl ID:
ENSDARG00000061850
Human Orthologue:
CAPN5
Human Description:
calpain 5 [Source:HGNC Symbol;Acc:1482]
Mouse Orthologue:
Capn5
Mouse Description:
calpain 5 Gene [Source:MGI Symbol;Acc:MGI:1100859]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6077 Nonsense Mutation detected in F1 DNA During 2014
sa20907 Essential Splice Site Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa6077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088686 Nonsense 52 641 1 13
Genomic Location:
Chromosome 7 (position 21633537)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCGAGTCGCTCTTCTACAGAAGGACGCCCCCTCCAGGACTGACATGG[A/T]AGAGACCCAGCGTATGAGTATCCTTTTTTGATTGTGCAAGTGCTAANNNNTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20907
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088686 Essential Splice Site 585 641 12 13
Genomic Location:
Chromosome 7 (position 21659587)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGCGATTTTTTACAGCAGGAAGCTGAAGTCAAAAATCTCCATTGAGG[T/G]CAGAAGCTAAACCACACTGTATTTTGATCATGTTTTATCATTGGCATATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/bfhh4oe9