ENSDARG00000061850

Ensembl ID:
ENSDARG00000061850
Human Orthologue:
CAPN5
Human Description:
calpain 5 [Source:HGNC Symbol;Acc:1482]
Mouse Orthologue:
Capn5
Mouse Description:
calpain 5 Gene [Source:MGI Symbol;Acc:MGI:1100859]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6077 Nonsense Mutation detected in F1 DNA During 2016
sa34042 Nonsense Mutation detected in F1 DNA During 2016
sa34043 Essential Splice Site Mutation detected in F1 DNA During 2016
sa20907 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa6077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088686 Nonsense 52 641 1 13
Genomic Location (Zv9):
Chromosome 7 (position 21633537)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20223973
KASP Assay ID:
554-3723.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAGCCGAGTCGCTCTTCTACAGAAGGACGCCCCCTCCAGGACTGACATGG[A/T]AGAGACCCAGCGTATGAGTATCCTTTTTTGATTGTGCAAGTGCTAANNNNTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34042
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088686 Nonsense 245 641 5 13
Genomic Location (Zv9):
Chromosome 7 (position 21635270)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20225706
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATTTTTTGTGTGTTACAGCCAGCAGAAGGGGAGGCTTTAGAATCAGTTT[T/A]GGACTGTGGACTAATAAAAGGTCATGCATATGGTGTGACTGCTGTCAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34043
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088686 Essential Splice Site 495 641 10 13
Genomic Location (Zv9):
Chromosome 7 (position 21657675)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20248111
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCCTGGTGCTACTGGGCGGTTCCTTCTGCGTTTTTTCTCACACTCACAT[G/A]TGCGCCTCAGGTAGAGACAAGAGAATTGGCCCTTTGCTAGCTCTGCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088686 Essential Splice Site 585 641 12 13
Genomic Location (Zv9):
Chromosome 7 (position 21659587)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 20250023
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAAGCGATTTTTTACAGCAGGAAGCTGAAGTCAAAAATCTCCATTGAGG[T/G]CAGAAGCTAAACCACACTGTATTTTGATCATGTTTTATCATTGGCATATA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link