col15a1b

Ensembl ID:
ENSDARG00000061848
ZFIN ID:
ZDB-GENE-070912-689
Description:
collagen alpha-1(XV) chain [Source:RefSeq peptide;Acc:NP_001165841]
Human Orthologue:
COL15A1
Human Description:
collagen, type XV, alpha 1 [Source:HGNC Symbol;Acc:2192]
Mouse Orthologue:
Col15a1
Mouse Description:
collagen, type XV, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88449]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3415 Nonsense Mutation detected in F1 DNA During 2014
sa11640 Essential Splice Site Available for shipment Available now
sa12573 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa3415
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088643 Nonsense 72 1149 1 36
ENSDART00000111483 Nonsense 153 236 2 2
ENSDART00000125548 Nonsense 97 235 3 4
ENSDART00000137065 None None 899 None 35

The following transcripts of ENSDARG00000061848 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 23884553)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCTTCTTCACAGACTTTGCCATCATCGTCACAGTCAAACCATCYAGCTCT[C/T]GAGGAGGAGTCCTGTTYGCCATCACAGACCCGTCCCAGACCATTGTCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11640
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088643 Essential Splice Site 429 1149 10 36
ENSDART00000111483 None None 236 None 2
ENSDART00000125548 None None 235 None 4
ENSDART00000137065 Essential Splice Site 108 899 5 35

The following transcripts of ENSDARG00000061848 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 23902855)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTGGGCTCTGGATTTGGAKATGCTGACATTGATACAGAACTTCTTCGGG[T/C]GAGTAAAATCARTTTTTGAAGACATGGNTTAAGCTATTTCAGTAAGACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12573
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088643 Nonsense 802 1149 28 36
ENSDART00000111483 None None 236 None 2
ENSDART00000125548 None None 235 None 4
ENSDART00000137065 Nonsense 477 899 23 35

The following transcripts of ENSDARG00000061848 do not overlap with this mutation:

Genomic Location:
Chromosome 2 (position 23915308)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATTATTTATAATGACTCATCTATTTTAAAGGGTCCACCAGGTCCACCT[G/T]GACCTCCAGGGCCACCAGGWCGAGTGATTGGCCTCAATGGAGTAAGTTTK
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dplg3x2r