im:7158374

Ensembl ID:
ENSDARG00000061844
ZFIN ID:
ZDB-GENE-060810-103
Human Orthologue:
ARHGEF15
Human Description:
Rho guanine nucleotide exchange factor (GEF) 15 [Source:HGNC Symbol;Acc:15590]
Mouse Orthologue:
Arhgef15
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 15 Gene [Source:MGI Symbol;Acc:MGI:3045246]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35285 Essential Splice Site Mutation detected in F1 DNA During 2016
sa6251 Nonsense Mutation detected in F1 DNA During 2016
sa22088 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35285
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088470 Essential Splice Site 766 937 11 15
Genomic Location (Zv9):
Chromosome 12 (position 23722629)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22245791
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTACCTCTTTCTTTTCAATGACCTACTTGTCATTGCCATCAAGAAAAG[G/A]TAAAATGCTGGAAAAACCTGTCTGTGTTATGCTTCACTTTGTTTCTTTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2016.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088470 Nonsense 809 937 12 15
Genomic Location (Zv9):
Chromosome 12 (position 23721475)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22244637
KASP Assay ID:
554-4547.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACATAGAGCACTGCTTCTGTCTGACGCTGCTGGAGAATCACCAGGGA[C/T]GACAGATGGAGAGAATCATGAAGGCTCCCTCACAGTGCGTGAAGTTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22088
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088470 Nonsense 854 937 14 15
Genomic Location (Zv9):
Chromosome 12 (position 23719633)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 22242795
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTGCTCTTGAATCACATGTGGTTTTGTATGTCAGATTGTCCTCAGGTG[C/T]AGTGTGTGGAGCAGTATGTGGCAAAACAATCGGATGAATTAAATCTGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link