im:7158374

Ensembl ID:
ENSDARG00000061844
ZFIN ID:
ZDB-GENE-060810-103
Human Orthologue:
ARHGEF15
Human Description:
Rho guanine nucleotide exchange factor (GEF) 15 [Source:HGNC Symbol;Acc:15590]
Mouse Orthologue:
Arhgef15
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 15 Gene [Source:MGI Symbol;Acc:MGI:3045246]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6251 Nonsense Mutation detected in F1 DNA During 2014
sa22088 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa6251
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088470 Nonsense 809 937 12 15
Genomic Location:
Chromosome 12 (position 23721475)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAACATAGAGCACTGCTTCTGTCTGACGCTGCTGGAGAATCACCAGGGA[C/T]GACAGATGGAGAGAATCATGAAGGCTCCCTCACAGTGCGTGAAGTTATAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22088
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088470 Nonsense 854 937 14 15
Genomic Location:
Chromosome 12 (position 23719633)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTTGCTCTTGAATCACATGTGGTTTTGTATGTCAGATTGTCCTCAGGTG[C/T]AGTGTGTGGAGCAGTATGTGGCAAAACAATCGGATGAATTAAATCTGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/og82twcs