tiparp

Ensembl ID:
ENSDARG00000061841
ZFIN IDs:
ZDB-GENE-031002-47, ZDB-GENE-031002-47
Description:
TCDD-inducible poly [Source:RefSeq peptide;Acc:NP_001038484]
Human Orthologue:
TIPARP
Human Description:
TCDD-inducible poly(ADP-ribose) polymerase [Source:HGNC Symbol;Acc:23696]
Mouse Orthologues:
Tiparp, Zc3hav1
Mouse Descriptions:
TCDD-inducible poly(ADP-ribose) polymerase Gene [Source:MGI Symbol;Acc:MGI:2159210]
zinc finger CCCH type, antiviral 1 Gene [Source:MGI Symbol;Acc:MGI:1926031]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15738 Nonsense Available for shipment Available now
sa10114 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15738
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088673 Nonsense 237 646 1 5
ENSDART00000088675 Nonsense 237 279 2 2
Genomic Location:
Chromosome 18 (position 32944096)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAGGGCGTTTGCGTCTATGGCAGTGACTGTGCCCAGCATCACACCGTTT[T/A]ACCTTACCACTGGCAAATCCGCAGAGTAGAWACGCAAATCTGGCAGAGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10114
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088673 Nonsense 560 646 5 5
ENSDART00000088675 None None 279 None 2
Genomic Location:
Chromosome 18 (position 32983678)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACGCCACCATGTTCGGCCAAGGCAGCTACTTTGCACGCAAGGCTGTGYA[T/G]TCCCRCAACTTCTCCAAGCGCTCGCCTAATGGTGTGCACTACATGTTCCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Ovarian cancer: A genome-wide association study identifies susceptibility loci for ovarian cancer at 2q31 and 8q24. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tyxlbejl