meox2b

Ensembl ID:
ENSDARG00000061818
ZFIN ID:
ZDB-GENE-060503-853
Description:
hypothetical protein LOC566969 [Source:RefSeq peptide;Acc:NP_001038589]
Human Orthologue:
MEOX2
Human Description:
mesenchyme homeobox 2 [Source:HGNC Symbol;Acc:7014]
Mouse Orthologue:
Meox2
Mouse Description:
mesenchyme homeobox 2 Gene [Source:MGI Symbol;Acc:MGI:103219]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23555 Nonsense Mutation detected in F1 DNA During 2014
sa16561 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23555
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088618 Nonsense 57 289 1 3
Genomic Location:
Chromosome 19 (position 32429061)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGGGACCTTCACCGCCCTGCAGCTACGCCGGGGAGGAGAGCAGTTTTGGA[G/T]GAGCTCATCACAGAGTTCACCCCGCTCCGCAGCATCCACATCACCCGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16561
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088618 Nonsense 161 289 2 3
Genomic Location:
Chromosome 19 (position 32433940)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGTGCATTTACAGCGGCTGGAAAGTGATCTGTTTTTCATTTCAGATTCC[C/T]AGGATGGGAGCTATAAGTCAGACRTGAGCAGTAAACCTAGGAAGGAGCGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/kezsoz39