LOC100330443

Ensembl ID:
ENSDARG00000061817
Human Orthologue:
KIF1A
Human Description:
kinesin family member 1A [Source:HGNC Symbol;Acc:888]
Mouse Orthologues:
Gm1305, Kif1a
Mouse Descriptions:
kinesin family member 1A Gene [Source:MGI Symbol;Acc:MGI:108391]
predicted gene 1305 Gene [Source:MGI Symbol;Acc:MGI:2686151]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11478 Nonsense Available for shipment Available now
sa12234 Nonsense Available for shipment Available now
sa20704 Essential Splice Site Mutation detected in F1 DNA During 2014
sa8231 Essential Splice Site Mutation detected in F1 DNA During 2014
sa13919 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11478
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088364 Nonsense 384 1681 12 47
Genomic Location:
Chromosome 6 (position 26907856)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGTGCGTGAGCTTAAAGATGAAGTGTCCCGTCTGAAAGACCTCCTCTA[T/A]GCCCAGGGCCTGGGTGACATCATTGAGAGTAAGRACATTTGCTGTTTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12234
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088364 Nonsense 598 1681 19 47
Genomic Location:
Chromosome 6 (position 26928486)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AYCGAATCATTTTGGGCAAGAGCCACGTGTTCCGCTTYAACCATCCAGAA[C/T]AGGCCCGTCAGGAACGTGACCGAACCCCCTGCGCTGAGACCCCAGTGGWG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20704
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088364 Essential Splice Site 744 1681 22 47
Genomic Location:
Chromosome 6 (position 26929297)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCTTCCTTAAAGAGGCCAATGCCATTAGTGTGGAGCTAAAGAAGAAG[G/A]TGAAAGCTTTAGTAAAAGAACCGGATCCTTTCATTGAACTAGAATATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa8231
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088364 Essential Splice Site 1391 1681 41 47
Genomic Location:
Chromosome 6 (position 26969839)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTSAGGATCTGAGAACTCATGATRTTCATTCATTTTCTTTTGRTATGTTA[G/T]GTGGAGAAAACCAGACACTACCTCCTCCTTAGGGAGAAGCTGGAGTCCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13919
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088364 Nonsense 1675 1681 47 47
Genomic Location:
Chromosome 6 (position 26977459)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACTTTCAGTAATCTTTCTYTTTCCCCCTCAGGTCTAAACTKTCCAGAAGG[A/T]GAGCTGGGCAGATGAGGTTTTAAGCCCACCACATGTRTACTCAATGTACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/oqhudxze