si:dkey-110c1.10

Ensembl ID:
ENSDARG00000061810
ZFIN ID:
ZDB-GENE-050208-429
Description:
Novel protein similar to vertebrate myosin VA (Heavy polypeptide 12, myoxin) (MYO5A) [Source:UniProt
Human Orthologue:
MYO5B
Human Description:
myosin VB [Source:HGNC Symbol;Acc:7603]
Mouse Orthologue:
Myo5b
Mouse Description:
myosin VB Gene [Source:MGI Symbol;Acc:MGI:106598]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa37497 Nonsense Mutation detected in F1 DNA During 2017
sa43819 Nonsense Mutation detected in F1 DNA During 2017
sa29765 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa37497
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088542 Nonsense 371 1836 10 41
ENSDART00000132951 Nonsense 366 1031 9 21
ENSDART00000139160   None 401 None 8

The following transcripts of ENSDARG00000061810 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 20601909)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20258602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGACCGTTCCTTGGCAGTCTTTGCCAAGCTTTTGAGGGTGGAAGGTGCT[C/T]AGATGGCCCAATGGCTATGCCACAGGAGACTAGCAGTGGGTGGGGAGATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43819
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088542 Nonsense 778 1836 18 41
ENSDART00000132951 Nonsense 777 1031 17 21
ENSDART00000139160   None 401 None 8

The following transcripts of ENSDARG00000061810 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 20599323)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20256016
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGGGTTTTGATCCAAAGCTGGGTGAGAGGATGGCAACAGCGTAGGCATTA[T/A]CAGCGGCTCCGGCAGGCCACATCTATCCTGCAGCGGTACACCAGAGGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29765
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088542 Missense 1359 1836 30 41
ENSDART00000132951   None 1031 None 21
ENSDART00000139160   None 401 None 8

The following transcripts of ENSDARG00000061810 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 20579147)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 20235840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCTTCAGCAGCTACAAGACAGAGACATGCCTGGAGATCCTGACAAAAAT[G/A]TAGCCAGTCTGTCGGAAACTACTGTTTGATGTTCTTTGGATTTTTTTGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link