si:dkey-174n20.3

Ensembl ID:
ENSDARG00000061806
ZFIN ID:
ZDB-GENE-060526-224
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A2BGW4]
Human Orthologues:
SEC24C, SEC24D
Human Descriptions:
SEC24 family, member C (S. cerevisiae) [Source:HGNC Symbol;Acc:10705]
SEC24 family, member D (S. cerevisiae) [Source:HGNC Symbol;Acc:10706]
Mouse Orthologues:
Sec24c, Sec24d
Mouse Descriptions:
Sec24 related gene family, member C (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919746]
Sec24 related gene family, member D (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1916858]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7559 Missense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa7559
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088578 Missense 257 765 7 18
ENSDART00000140298   None 326 None 7
Genomic Location (Zv9):
Chromosome 5 (position 22831939)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20544811
KASP Assay ID:
554-4061.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACATGATGGTCATCACTGACTGTGAGGAGCTGGAGCTTCCTGTGCTGGAC[G/A]GGCTTCTGGTGCCGCTGAAAGACTGCAGACACATAATTGARAGGTTCTGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link