si:ch211-194e15.5

Ensembl ID:
ENSDARG00000061804
ZFIN ID:
ZDB-GENE-060503-393
Description:
Uncharacterized protein KIAA1522 homolog [Source:UniProtKB/Swiss-Prot;Acc:Q1LWM5]
Human Orthologue:
KIAA1522
Human Description:
KIAA1522 [Source:HGNC Symbol;Acc:29301]
Mouse Orthologue:
C77080
Mouse Description:
expressed sequence C77080 Gene [Source:MGI Symbol;Acc:MGI:2140651]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15406 Nonsense Available for shipment Available now
sa1502 Nonsense Available for shipment Available now
sa13145 Nonsense Available for shipment Available now
sa11053 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa15406
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088573 Nonsense 40 1394 1 7
ENSDART00000137633   None 1325 None 5
Genomic Location (Zv9):
Chromosome 19 (position 32208663)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31375952
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAGTAARAAGAAACGTGGTTCATCTTTAAGTCGGGCTTTTAGTTGGTTC[A/T]AGGGCAGCAAGCGCAAGAGGAGTCTCAGCAATGGACAGAGCAGGTCAGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1502
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088573 Nonsense 340 1394 6 7
ENSDART00000137633 Nonsense 265 1325 5 5
Genomic Location (Zv9):
Chromosome 19 (position 32145836)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31313125
KASP Assay ID:
554-1427.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTACAAGAGCCTCAAGGCCCTGTTATGTCTATTYCTCCACAGGCAACATA[T/A]TTATCTAAGATTATTCCAAATGCAGTTTTGCCAGCTGCAATAGATATCAT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa13145
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088573 Nonsense 830 1394 6 7
ENSDART00000137633 Nonsense 755 1325 5 5
Genomic Location (Zv9):
Chromosome 19 (position 32144368)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31311657
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATTAAAAAGTCCAGAAACACTTGCAAAGGTWAACCAGATCCCTCACACA[C/T]AAGATGAGAAAACGAYAGAGGACCAAAAGGACAGATGGAGTCAAAYACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11053
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088573 Nonsense 1163 1394 6 7
ENSDART00000137633 Nonsense 1088 1325 5 5
Genomic Location (Zv9):
Chromosome 19 (position 32143369)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 31310658
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTCTTTACTCCAGATGGTGCGACTAAGATCTGTAAATGTWGGTGAAGAC[C/T]AAGTAAACAACGATTCCAAACCAAGTACTGAGCCTACAACAAATGAGGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link