LOC566523

Ensembl ID:
ENSDARG00000061798
Human Orthologue:
ARHGAP27
Human Description:
Rho GTPase activating protein 27 [Source:HGNC Symbol;Acc:31813]
Mouse Orthologue:
Arhgap27
Mouse Description:
Rho GTPase activating protein 27 Gene [Source:MGI Symbol;Acc:MGI:1916903]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa10283 Nonsense Available for shipment Available now
sa15505 Essential Splice Site Available for shipment Available now
sa13044 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10283
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088531 Nonsense 463 1014 3 18
Genomic Location:
Chromosome 3 (position 22618508)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTGCCAGAAGAGGACTACCCAAAAAATCAACATRAGGAATCTCATATTT[C/A]ATTTCAGCTCCCTAAGGATTTCCAATTGCCTCAAATCAAGCGCGCCGKCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15505
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088531 Essential Splice Site 851 1014 15 18
Genomic Location:
Chromosome 3 (position 22629601)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATGTTCATCAGTTTAAGATAAAGGTCATCTGAATGTGTTTGCTTGCTTC[A/C]GGTCTCAAAATAGATGGAATCTACAGAGTGAGCGGAAACCTTGCTGTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13044
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088531 Essential Splice Site 877 1014 15 18
Genomic Location:
Chromosome 3 (position 22629682)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCGGAAACCTTGCTGTCATTCAGAAGCTGCGATRTAAAGCTGACCAYGG[T/C]AAACACAATCTAGATTAMAAAGATCACTACAGTTACAGTGAGGACAGAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/5xroy38p