si:dkey-12o15.1

Ensembl ID:
ENSDARG00000061796
ZFIN ID:
ZDB-GENE-050419-110
Description:
RAS guanyl-releasing protein 1 [Source:RefSeq peptide;Acc:NP_001038327]
Human Orthologue:
RASGRP4
Human Description:
RAS guanyl releasing protein 4 [Source:HGNC Symbol;Acc:18958]
Mouse Orthologue:
Rasgrp4
Mouse Description:
RAS guanyl releasing protein 4 Gene [Source:MGI Symbol;Acc:MGI:2386851]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23342 Essential Splice Site, Missense, Splice Site Available for shipment Available now
sa23343 Essential Splice Site Available for shipment Available now
sa15171 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23342
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site, Missense, Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088504 Missense, Splice Site 107 687 4 16
ENSDART00000140386 Essential Splice Site 108 687 None 16
Genomic Location (Zv9):
Chromosome 18 (position 34100203)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35779359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGTCTGTAGTCACACTGTTGTGTGCTTTCTCCTTGACTTGTGATCACAT[A/T]TAAGGATTGTCCTGCAGAGAAAAGGGGACAAAGGCGTCCACAAATCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23343
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088504 Essential Splice Site 506 687 12 16
ENSDART00000140386 Essential Splice Site 506 687 12 16
Genomic Location (Zv9):
Chromosome 18 (position 34131192)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35810348
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGATTGCTGCCAATTTCCCCTTCTCTTTCTGCACACATGAGAGTGATAG[G/A]TAAGGGAAGAACTGTTACACTAATGATTTAGTTTAGGTTTTGTAAGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15171
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088504 Essential Splice Site 568 687 14 16
ENSDART00000140386 Essential Splice Site 568 687 14 16
Genomic Location (Zv9):
Chromosome 18 (position 34134603)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 35813759
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTTTTCCATTAGTTATGGGGAGTCATAAAACAAGGCTATCACTGCAAAG[G/A]TTACAAKATCTCAATCAAYCAGTCTTAATACTGTATATAATTACACCTCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link