jam3b

Ensembl ID:
ENSDARG00000061794
ZFIN ID:
ZDB-GENE-030131-441
Description:
junctional adhesion molecule 3b [Source:RefSeq peptide;Acc:NP_001076332]
Human Orthologue:
JAM3
Human Description:
junctional adhesion molecule 3 [Source:HGNC Symbol;Acc:15532]
Mouse Orthologue:
Jam3
Mouse Description:
junction adhesion molecule 3 Gene [Source:MGI Symbol;Acc:MGI:1933825]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14980 Essential Splice Site Available for shipment Available now
sa37 Missense Confirmed mutation in F2 line During 2014
sa16151 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14980
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088546 Essential Splice Site 71 333 2 9
ENSDART00000128297 Essential Splice Site 26 288 2 9
ENSDART00000128795 Essential Splice Site 52 314 2 9
Genomic Location:
Chromosome 21 (position 24312444)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTCCTCCTGAAGTCGACGAATTCTAAACCGTGGGTCAACGAGTTTGAATG[T/G]AAGGCTGARTAATTTAACTCCTGCAGTCTGATTTTAACATTAAACAGGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37
Current Status:
Confirmed mutation in F2 line
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088546 Missense 167 333 5 9
ENSDART00000128297 Missense 122 288 5 9
ENSDART00000128795 Missense 148 314 5 9
Genomic Location:
Chromosome 21 (position 24315130)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAAGATGATTCTCTTGTATGTCATGCAGTGAAGCCAGTCGTGCCAAGAT[G/A]CTCTGTGCCCAAGTCTATCCCGGTGGGCAAACCAGCAGAGCTGCATTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16151
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088546 Nonsense 218 333 5 9
ENSDART00000128297 Nonsense 173 288 5 9
ENSDART00000128795 Nonsense 199 314 5 9
Genomic Location:
Chromosome 21 (position 24315284)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAATCCCRCTAGATCCCAAGAGCAGCCCAAAGTTCTTCAACTCMACTTA[C/A]ACCCTAGAYGGGGAAATGGGCACGCTGGTGAGTTGGGGTAGACGGAGGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/beu81gxy