nyx

Ensembl ID:
ENSDARG00000061791
ZFIN ID:
ZDB-GENE-061026-3
Description:
nyctalopin [Source:RefSeq peptide;Acc:NP_001071085]
Human Orthologue:
NYX
Human Description:
nyctalopin [Source:HGNC Symbol;Acc:8082]
Mouse Orthologue:
Nyx
Mouse Description:
nyctalopin Gene [Source:MGI Symbol;Acc:MGI:2448607]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa31731 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31731
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088569 Nonsense 342 469 2 2
Genomic Location (Zv9):
Chromosome 9 (position 34393306)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33549252
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCTATATCTTTTTCGAAACCCCTGGGAGTGTACCTGCGACCTGGAGT[G/A]GTTAAGGGAGTGGATGGAGAGTTATAAGTTGGTGAGGGACATCCCGTGCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link