gnl1

Ensembl ID:
ENSDARG00000061789
ZFIN ID:
ZDB-GENE-060323-1
Description:
guanine nucleotide-binding protein-like 1 [Source:RefSeq peptide;Acc:NP_001070721]
Human Orthologue:
GNL1
Human Description:
guanine nucleotide binding protein-like 1 [Source:HGNC Symbol;Acc:4413]
Mouse Orthologue:
Gnl1
Mouse Description:
guanine nucleotide binding protein-like 1 Gene [Source:MGI Symbol;Acc:MGI:95764]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa12323 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa12323
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088513 Essential Splice Site 414 602 9 12
Genomic Location:
Chromosome 16 (position 23817066)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTGTCCCGGGCTYGTCTTCCCTTCGCGGGTGGACAAGCAACTACAGG[T/C]AAAAACACGATACTCCATCTTTACCCCAGTTAAATCATCCAGTCWGTGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/rm1wrhs5