si:ch211-287c11.1

Ensembl ID:
ENSDARG00000061786
ZFIN ID:
ZDB-GENE-090312-193
Human Orthologue:
KLHL2
Human Description:
kelch-like 2, Mayven (Drosophila) [Source:HGNC Symbol;Acc:6353]
Mouse Orthologue:
Klhl2
Mouse Description:
kelch-like 2, Mayven (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1924363]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11656 Nonsense Available for shipment Available now
sa19477 Essential Splice Site Available for shipment Available now
sa11806 Nonsense Available for shipment Available now
sa13276 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11656
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088545 Nonsense 68 590 3 15
Genomic Location (Zv9):
Chromosome 1 (position 19743465)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20269224
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTGTGTGATGTCACCATCATTGCRGAGGATGTGGAGATTGCCGCTCAT[C/T]GAGTCGTCTTAGCTGCAGGGAGTCCTTACTTCCATGCTATGTTTACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19477
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088545 Essential Splice Site 254 590 7 15
Genomic Location (Zv9):
Chromosome 1 (position 19732453)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20258212
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GATGGAACATGTTCGCTTGCCGCTTCTTTCCAGAGAATACCTTGTACAGG[T/C]AGGTGTGTGTGTGTGTGTGTGTGTGTGTGTGAATGCTTGCATATGCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11806
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088545 Nonsense 466 590 12 15
Genomic Location (Zv9):
Chromosome 1 (position 19723056)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20248815
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGAGGTTATGACGGAGCCACACGTCAGTGTTTGAGTACAGTGGAGGCCTA[T/G]AATCCCAACACTAATGAATGGTCTTACACAGCAGAGATGGGCACCCGGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13276
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088545 Nonsense 573 590 14 15
Genomic Location (Zv9):
Chromosome 1 (position 19715568)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 20241327
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GTGGAGTTTTACAATCCAAACACYGATAAATGGACTCTTCTCCCTACCTG[C/A]ATGAGCACTGGACGCAGCTACGCAGGTGAGGGACAYAAAGCCAGGGTTAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link