si:dkey-13n15.4

Ensembl ID:
ENSDARG00000061784
ZFIN ID:
ZDB-GENE-060526-210
Description:
rho GTPase-activating protein 25 [Source:RefSeq peptide;Acc:NP_001119876]
Human Orthologue:
ARHGAP25
Human Description:
Rho GTPase activating protein 25 [Source:HGNC Symbol;Acc:28951]
Mouse Orthologue:
Arhgap25
Mouse Description:
Rho GTPase activating protein 25 Gene [Source:MGI Symbol;Acc:MGI:2443687]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1027 Nonsense F2 line generated During 2017
sa20383 Nonsense Available for shipment Available now
sa31427 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa1027
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088506 Nonsense 227 600 6 10
Genomic Location (Zv9):
Chromosome 5 (position 22977019)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20689891
KASP Assay ID:
554-0931.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGACTAACTGCATTTAATCTGATCAATCCAAGGGCAAAGAGAAGCTGGAG[A/T]AACAAATTAGTTTACTGCCAAAAGTGAACTACAACCTCCTGAGTTACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20383
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088506 Nonsense 228 600 6 10
Genomic Location (Zv9):
Chromosome 5 (position 22977022)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20689894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTAACTGCATTTAATCTGATCAATCCAAGGGCAAAGAGAAGCTGGAGAAA[C/T]AAATTAGTTTACTGCCAAAAGTGAACTACAACCTCCTGAGTTACATCTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31427
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088506 Nonsense 384 600 9 10
Genomic Location (Zv9):
Chromosome 5 (position 22983899)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 20696771
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAAAGCACAACTCTTTCTCCCACTGAGTTTTCGGTCACAACAGACACATG[G/A]CCCGAGAGCCCTAGAAAGCGGACACAAACTCTACCCAGTTTAGGTTGTCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link