fmn2b

Ensembl ID:
ENSDARG00000061778
ZFIN ID:
ZDB-GENE-080225-35
Human Orthologue:
FMN2
Human Description:
formin 2 [Source:HGNC Symbol;Acc:14074]
Mouse Orthologue:
Fmn2
Mouse Description:
formin 2 Gene [Source:MGI Symbol;Acc:MGI:1859252]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa7707 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa7707
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105328 Nonsense 555 1454 1 18
Genomic Location:
Chromosome 12 (position 48705013)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATCCGAACGCTTCCTCCAAAGACAAMAGGCTCTGCGGATTATCTGGAATA[T/A]GGTGGCTCGGAGGGAACACTGCGGAGYGACCGGACACTCAGCGCTTCTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/xf2gcrxr