bmp10

Ensembl ID:
ENSDARG00000061769
ZFIN ID:
ZDB-GENE-060526-211
Description:
bone morphogenetic protein 10 [Source:RefSeq peptide;Acc:NP_001124072]
Human Orthologue:
BMP10
Human Description:
bone morphogenetic protein 10 [Source:HGNC Symbol;Acc:20869]
Mouse Orthologue:
Bmp10
Mouse Description:
bone morphogenetic protein 10 Gene [Source:MGI Symbol;Acc:MGI:1338820]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa7560 Missense Mutation detected in F1 DNA During 2014
sa20384 Nonsense Mutation detected in F1 DNA During 2014
sa16377 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7560
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088492 Missense 126 485 1 2
Genomic Location:
Chromosome 5 (position 22994838)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTCTACAACCGATTCGCCAATGACCGAACAGCAATGCCTTCGGCAAAC[A/T]TCRTACGCAGCTTTAAAAATGAAGGTAACTGCATATTTTCCTATTCAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20384
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088492 Nonsense 271 485 2 2
Genomic Location:
Chromosome 5 (position 22996980)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCACAAGCTGGAGGTCCACATAGCAAGTTTGGACTCTCAGAGTGTGGCC[G/T]AAGGTGAAAATATAAGCAATGCCATAGGGGGAGACATGGACATTGACACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16377
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088492 Nonsense 476 485 2 2
Genomic Location:
Chromosome 5 (position 22997595)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
KGCTCWACCTAGATGACGCAGGTGTGGTCACGTATCAGTATAAATTTGAA[G/T]GAATGGTAGTGGCCAAGTGTGGATGCAGAWAGTATTTAATGGACAWGGGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/tbdhw2jl