ahnak

Ensembl ID:
ENSDARG00000061764
ZFIN IDs:
ZDB-GENE-030131-8719, ZDB-GENE-030131-8719
Description:
Ahnak protein [Source:UniProtKB/TrEMBL;Acc:Q08BG5]
Human Orthologue:
AHNAK
Human Description:
AHNAK nucleoprotein [Source:HGNC Symbol;Acc:347]
Mouse Orthologue:
Ahnak
Mouse Description:
AHNAK nucleoprotein (desmoyokin) Gene [Source:MGI Symbol;Acc:MGI:1316648]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa3886 Nonsense Mutation detected in F1 DNA During 2014
sa22488 Nonsense Mutation detected in F1 DNA During 2014
sa22489 Nonsense Mutation detected in F1 DNA During 2014
sa13008 Essential Splice Site Available for shipment Available now
sa17896 Nonsense Available for shipment Available now
sa6345 Nonsense Mutation detected in F1 DNA During 2014
sa22490 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa3886
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 Nonsense 783 848 5 5
ENSDART00000125289 Nonsense 783 5689 3 5
Genomic Location:
Chromosome 14 (position 27787542)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGTTGAAGGGGCAAAAAGTGGAGGGTCCAGGTTTTGATGTAAAAATCTCC[A/T]AAGCTGATGTTGAACTTAAGGAATCAAATTTAAACATTAAAGCTTCAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22488
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 2806 5689 3 5
Genomic Location:
Chromosome 14 (position 27793611)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACATTAAGGCACCTGATTTGGACATTAAATCTCCAGAGATTGACATT[G/T]AGGGACCTGAGGGAAAAGTAAAGGGGTCCAAGTTCAAAATACCTTTCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22489
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 4172 5689 4 5
Genomic Location:
Chromosome 14 (position 27799806)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATGCCAAAGATTTCTATGCCAGAAGTTGATTTCAATCTGAAAGGACCA[A/T]AACTGAAAGGTGATGTTGATTTTTCCGTTCCAAAAGTCGAAGGAGACGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13008
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Essential Splice Site 5299 5689 5 5
Genomic Location:
Chromosome 14 (position 27803273)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GATGTTGATTTGCCATCGGCAAGCCTTAAAACTGACATTCAGACACCAGA[T/G]GCTAGTTTGGACAGTCCAGATTTGAAAACGAAAGGGGCAAAAGTAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17896
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 5538 5689 5 5
Genomic Location:
Chromosome 14 (position 27803992)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAGATGCTGATGCTACTAGTAAAGGTGCTGCTAAAGTGTCTAAGGAGT[T/A]GAGTCTTAGTTCTGGGGAACTGACAAGTGGCAAGTTAACAGTAGAGGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6345
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 5598 5689 5 5
Genomic Location:
Chromosome 14 (position 27804172)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTCAGTGAAGAGGGAGCCTTAGCTTCACCTGTTTCTACTGAAGGGCAMT[T/G]ACAAGCAGAAGCTGGCAATGTTTCTCTAGATGTTGGAGACACTAAGGTTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22490
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088484 None None 848 None 5
ENSDART00000125289 Nonsense 5615 5689 5 5
Genomic Location:
Chromosome 14 (position 27804222)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACAAGCAGAAGCTGGCAATGTTTCTCTAGATGTTGGAGACACTAAGGTT[A/T]AAGGCAAAAAAGGAAAGTTGAAGTTCTCTACAATTGGAGGTTTTAGTTCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/8t0vm0hm