si:ch211-154o6.7

Ensembl ID:
ENSDARG00000061762
ZFIN ID:
ZDB-GENE-060503-670
Description:
hypothetical protein LOC568750 [Source:RefSeq peptide;Acc:NP_001038633]
Human Orthologue:
TRIM69
Human Description:
tripartite motif-containing 69 [Source:HGNC Symbol;Acc:17857]
Mouse Orthologue:
Trim69
Mouse Description:
tripartite motif-containing 69 Gene [Source:MGI Symbol;Acc:MGI:1918178]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36105 Nonsense Mutation detected in F1 DNA During 2017

Mutation Details

Allele Name:
sa36105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2017.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088407 Nonsense 87 523 1 6
Genomic Location (Zv9):
Chromosome 16 (position 23986551)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 21997289
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAGCCTGGGACCAAGTGCCTGTCCAGAATGCCAAAAACCTTACAACGAA[A/T]AAGACCTGAAATCCAGCCGTTTACTGAGAAACATGACCTCGACAGTACGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link