kdm6a

Ensembl ID:
ENSDARG00000061759
ZFIN ID:
ZDB-GENE-081105-56
Description:
Novel protein similar to human and mouse ubiquitously transcribed tetratricopeptide repeat, X chromo
Human Orthologues:
KDM6A, UTY
Human Descriptions:
lysine (K)-specific demethylase 6A [Source:HGNC Symbol;Acc:12637]
ubiquitously transcribed tetratricopeptide repeat gene, Y-linked [Source:HGNC Symbol;Acc:12638]
Mouse Orthologues:
Kdm6a, Uty
Mouse Descriptions:
4lysine (K)-specific demethylase 6A Gene [Source:MGI Symbol;Acc:MGI:1095419]
ubiquitously transcribed tetratricopeptide repeat gene, Y chromosome Gene [Source:MGI Symbol;Acc:MGI

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa17907 Essential Splice Site Available for shipment Available now
sa7197 Nonsense Mutation detected in F1 DNA During 2014

Mutation Details

Allele Name:
sa17907
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088469 Essential Splice Site 294 1437 None 30
ENSDART00000144623 Essential Splice Site 294 471 None 14

The following transcripts of ENSDARG00000061759 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 34792156)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGTAACTTTCCTAAAAGTCTCTATATTTGGTGTTTTCGTTTATCTTCM[A/T]GGTGCTACTCAAGTATTGGGAAGGTTCAAGATGCCTTCATATCTTACCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7197
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2014.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088469 Nonsense 722 1437 18 30
ENSDART00000144623 None None 471 None 14

The following transcripts of ENSDARG00000061759 do not overlap with this mutation:

Genomic Location:
Chromosome 9 (position 34802952)
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGACGTCCCAGCCTTCCCCGGCAGCCGGCACTGGCGGTCCAAATCAGGTC[G/T]GACATTCGGCCACAGCCAGCGACACGCAAGCGCAGGAGGCCAGTCACAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

* quick link - http://q.sanger.ac.uk/dmco9mqa