SH3PXD2A (2 of 2)

Ensembl ID:
ENSDARG00000061758
Description:
SH3 and PX domains 2A [Source:HGNC Symbol;Acc:23664]
Human Orthologue:
SH3PXD2A
Human Description:
SH3 and PX domains 2A [Source:HGNC Symbol;Acc:23664]
Mouse Orthologue:
Sh3pxd2a
Mouse Description:
SH3 and PX domains 2A Gene [Source:MGI Symbol;Acc:MGI:1298393]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23047 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa23047
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088478 Nonsense 247 763 7 9
Genomic Location (Zv9):
Chromosome 17 (position 20355022)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 20505033
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTGCTTCAGGGTTTTCAGCTGCCGCAGCCGCCGGATCCCCCTACTGTT[G/T]AAGCGGAGTATTACACCATCGCGGAGTTTCGCTCCTGCCTGACCGACGGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link